Incidental Mutation 'R4490:Cngb3'
ID330671
Institutional Source Beutler Lab
Gene Symbol Cngb3
Ensembl Gene ENSMUSG00000056494
Gene Namecyclic nucleotide gated channel beta 3
SynonymsCCNC2, CNG6, Cngbeta2
MMRRC Submission 041746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4490 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location19280850-19510623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19415684 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 398 (I398T)
Ref Sequence ENSEMBL: ENSMUSP00000100064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102999]
Predicted Effect probably benign
Transcript: ENSMUST00000102999
AA Change: I398T

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100064
Gene: ENSMUSG00000056494
AA Change: I398T

DomainStartEndE-ValueType
Pfam:Ion_trans 210 445 5.7e-21 PFAM
cNMP 516 635 5.99e-23 SMART
Meta Mutation Damage Score 0.3019 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of a cyclic nucleotide-gated ion channel. The encoded beta subunit appears to play a role in modulation of channel function in cone photoreceptors. This heterotetrameric channel is necessary for sensory transduction, and mutations in this gene have been associated with achromatopsia 3, progressive cone dystrophy, and juvenile macular degeneration, also known as Stargardt Disease. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cone degeneration and decreased photopic response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,633,779 V417A probably damaging Het
Adgrb2 T C 4: 130,012,328 V881A possibly damaging Het
Arl5c G A 11: 97,995,836 R10* probably null Het
Atad1 A G 19: 32,695,797 C229R probably benign Het
Atp6v0a2 T C 5: 124,646,734 V319A probably damaging Het
Cage1 A G 13: 38,023,417 S257P possibly damaging Het
Ccndbp1 A G 2: 121,012,395 D179G probably damaging Het
Crmp1 A G 5: 37,276,331 D178G probably damaging Het
Csmd3 C T 15: 48,314,033 V370I possibly damaging Het
Dapk1 A G 13: 60,718,128 T180A probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
F5 T C 1: 164,217,395 V2084A probably benign Het
Fan1 A T 7: 64,369,180 S476T possibly damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Gbp2 A G 3: 142,623,764 N24S probably benign Het
Gm14325 T C 2: 177,832,983 H101R possibly damaging Het
Gpr55 C T 1: 85,941,818 V14M probably damaging Het
Herc6 A T 6: 57,654,495 Y724F probably damaging Het
Impg1 T A 9: 80,394,059 Q195L probably damaging Het
Inf2 T C 12: 112,600,204 F68L probably damaging Het
Kcnh8 T C 17: 52,961,877 probably null Het
Klb A G 5: 65,375,794 N482S probably benign Het
Kpnb1 A G 11: 97,171,598 V447A probably benign Het
Nckap5l G A 15: 99,426,130 P831S probably benign Het
Ncor2 A G 5: 125,036,815 probably null Het
Olfr32 A T 2: 90,138,917 V74D probably damaging Het
Pgm3 T C 9: 86,561,840 Y337C probably damaging Het
Prdm1 G T 10: 44,446,907 Y197* probably null Het
Prdm4 A T 10: 85,900,899 C626S probably damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ranbp6 A G 19: 29,810,333 L873P probably damaging Het
Rin2 A G 2: 145,822,274 T23A possibly damaging Het
Rxra G T 2: 27,741,195 R118L probably damaging Het
Spice1 T C 16: 44,382,113 L750P probably damaging Het
Trpm1 C T 7: 64,208,912 Q228* probably null Het
Tsc1 A G 2: 28,670,925 D265G probably damaging Het
Usp29 T C 7: 6,961,950 I264T possibly damaging Het
Vmn2r26 T C 6: 124,050,738 L479P possibly damaging Het
Zfp9 A G 6: 118,465,312 S130P probably benign Het
Other mutations in Cngb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Cngb3 APN 4 19280956 missense probably damaging 0.98
IGL01301:Cngb3 APN 4 19425625 missense probably damaging 1.00
IGL01735:Cngb3 APN 4 19415648 missense probably damaging 1.00
IGL01756:Cngb3 APN 4 19367850 missense probably damaging 1.00
IGL01812:Cngb3 APN 4 19461728 missense possibly damaging 0.86
IGL02123:Cngb3 APN 4 19367801 missense probably damaging 0.99
IGL02636:Cngb3 APN 4 19396690 missense probably damaging 1.00
IGL02648:Cngb3 APN 4 19428489 missense probably benign 0.00
IGL02935:Cngb3 APN 4 19425491 missense possibly damaging 0.95
IGL03025:Cngb3 APN 4 19283498 splice site probably benign
IGL03068:Cngb3 APN 4 19375246 missense possibly damaging 0.92
ANU18:Cngb3 UTSW 4 19425625 missense probably damaging 1.00
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0195:Cngb3 UTSW 4 19280975 missense probably benign 0.00
R0361:Cngb3 UTSW 4 19366467 missense probably benign 0.00
R0480:Cngb3 UTSW 4 19309517 splice site probably benign
R1103:Cngb3 UTSW 4 19309658 critical splice donor site probably null
R1450:Cngb3 UTSW 4 19395922 splice site probably benign
R1618:Cngb3 UTSW 4 19364260 missense probably benign
R1891:Cngb3 UTSW 4 19366446 missense probably benign 0.00
R2196:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R2850:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R3909:Cngb3 UTSW 4 19461679 missense probably damaging 1.00
R3941:Cngb3 UTSW 4 19396786 missense probably benign 0.00
R4348:Cngb3 UTSW 4 19396688 missense probably damaging 1.00
R4493:Cngb3 UTSW 4 19367778 missense probably damaging 1.00
R4578:Cngb3 UTSW 4 19425613 missense probably damaging 1.00
R4719:Cngb3 UTSW 4 19309562 missense probably benign
R4774:Cngb3 UTSW 4 19415713 missense possibly damaging 0.85
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4898:Cngb3 UTSW 4 19395926 missense probably benign 0.08
R5216:Cngb3 UTSW 4 19415729 missense possibly damaging 0.93
R5647:Cngb3 UTSW 4 19364266 missense possibly damaging 0.51
R5945:Cngb3 UTSW 4 19283579 missense probably null 0.00
R6586:Cngb3 UTSW 4 19280946 missense probably damaging 0.99
R6650:Cngb3 UTSW 4 19364168 missense probably damaging 1.00
R6651:Cngb3 UTSW 4 19375231 missense probably benign 0.01
R7070:Cngb3 UTSW 4 19425593 missense possibly damaging 0.78
R7316:Cngb3 UTSW 4 19425599 missense probably benign 0.16
R7371:Cngb3 UTSW 4 19425575 missense possibly damaging 0.69
R7554:Cngb3 UTSW 4 19461753 nonsense probably null
R7755:Cngb3 UTSW 4 19461684 missense probably benign 0.01
X0062:Cngb3 UTSW 4 19364189 missense possibly damaging 0.91
X0067:Cngb3 UTSW 4 19367753 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATACCCTCCTTGTGTTTAAGTG -3'
(R):5'- GGACCACAGATTTCAATAGTTCTTCC -3'

Sequencing Primer
(F):5'- ACCCTCCTTGTGTTTAAGTGTTTAG -3'
(R):5'- ACATTGCCAGCTTACCTG -3'
Posted On2015-07-21