Incidental Mutation 'R4490:Trpm1'
ID 330684
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission 041746-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4490 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 64153835-64269775 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 64208912 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 228 (Q228*)
Ref Sequence ENSEMBL: ENSMUSP00000146265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206706] [ENSMUST00000206314] [ENSMUST00000205994]
AlphaFold Q2TV84
Predicted Effect probably null
Transcript: ENSMUST00000032737
AA Change: Q245*
SMART Domains Protein: ENSMUSP00000032737
Gene: ENSMUSG00000030523
AA Change: Q245*

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083651
Predicted Effect probably null
Transcript: ENSMUST00000085222
AA Change: Q361*
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: Q361*

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107515
AA Change: Q228*
SMART Domains Protein: ENSMUSP00000103139
Gene: ENSMUSG00000030523
AA Change: Q228*

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 323 358 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107519
AA Change: Q245*
SMART Domains Protein: ENSMUSP00000103143
Gene: ENSMUSG00000030523
AA Change: Q245*

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
low complexity region 505 534 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
transmembrane domain 760 779 N/A INTRINSIC
Pfam:Ion_trans 791 1004 1.3e-15 PFAM
transmembrane domain 1034 1051 N/A INTRINSIC
low complexity region 1100 1109 N/A INTRINSIC
PDB:3E7K|H 1112 1163 1e-7 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107525
AA Change: Q361*
SMART Domains Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: Q361*

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
Pfam:Ion_trans 876 1138 7.6e-22 PFAM
transmembrane domain 1156 1173 N/A INTRINSIC
Pfam:TRPM_tetra 1230 1285 9.4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141574
AA Change: Q417*
Predicted Effect probably null
Transcript: ENSMUST00000153421
AA Change: Q361*
SMART Domains Protein: ENSMUSP00000135595
Gene: ENSMUSG00000030523
AA Change: Q361*

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 445 461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177102
AA Change: Q245*
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: Q245*

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000205348
AA Change: Q361*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205610
Predicted Effect probably null
Transcript: ENSMUST00000205731
AA Change: Q245*
Predicted Effect probably null
Transcript: ENSMUST00000206263
AA Change: Q245*
Predicted Effect probably null
Transcript: ENSMUST00000206277
AA Change: Q361*
Predicted Effect probably null
Transcript: ENSMUST00000206706
AA Change: Q228*
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect probably benign
Transcript: ENSMUST00000205684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206453
Predicted Effect probably benign
Transcript: ENSMUST00000205994
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,633,779 V417A probably damaging Het
Adgrb2 T C 4: 130,012,328 V881A possibly damaging Het
Arl5c G A 11: 97,995,836 R10* probably null Het
Atad1 A G 19: 32,695,797 C229R probably benign Het
Atp6v0a2 T C 5: 124,646,734 V319A probably damaging Het
Cage1 A G 13: 38,023,417 S257P possibly damaging Het
Ccndbp1 A G 2: 121,012,395 D179G probably damaging Het
Cngb3 T C 4: 19,415,684 I398T probably benign Het
Crmp1 A G 5: 37,276,331 D178G probably damaging Het
Csmd3 C T 15: 48,314,033 V370I possibly damaging Het
Dapk1 A G 13: 60,718,128 T180A probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
F5 T C 1: 164,217,395 V2084A probably benign Het
Fan1 A T 7: 64,369,180 S476T possibly damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Gbp2 A G 3: 142,623,764 N24S probably benign Het
Gm14325 T C 2: 177,832,983 H101R possibly damaging Het
Gpr55 C T 1: 85,941,818 V14M probably damaging Het
Herc6 A T 6: 57,654,495 Y724F probably damaging Het
Impg1 T A 9: 80,394,059 Q195L probably damaging Het
Inf2 T C 12: 112,600,204 F68L probably damaging Het
Kcnh8 T C 17: 52,961,877 probably null Het
Klb A G 5: 65,375,794 N482S probably benign Het
Kpnb1 A G 11: 97,171,598 V447A probably benign Het
Nckap5l G A 15: 99,426,130 P831S probably benign Het
Ncor2 A G 5: 125,036,815 probably null Het
Olfr32 A T 2: 90,138,917 V74D probably damaging Het
Pgm3 T C 9: 86,561,840 Y337C probably damaging Het
Prdm1 G T 10: 44,446,907 Y197* probably null Het
Prdm4 A T 10: 85,900,899 C626S probably damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ranbp6 A G 19: 29,810,333 L873P probably damaging Het
Rin2 A G 2: 145,822,274 T23A possibly damaging Het
Rxra G T 2: 27,741,195 R118L probably damaging Het
Spice1 T C 16: 44,382,113 L750P probably damaging Het
Tsc1 A G 2: 28,670,925 D265G probably damaging Het
Usp29 T C 7: 6,961,950 I264T possibly damaging Het
Vmn2r26 T C 6: 124,050,738 L479P possibly damaging Het
Zfp9 A G 6: 118,465,312 S130P probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 splice site probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
R7776:Trpm1 UTSW 7 64248191 missense probably benign 0.04
R8062:Trpm1 UTSW 7 64201941 missense probably benign 0.18
R8069:Trpm1 UTSW 7 64208970 missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 64199269 missense probably damaging 1.00
R8219:Trpm1 UTSW 7 64201951 missense probably benign 0.35
R8258:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8259:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8320:Trpm1 UTSW 7 64268793 missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 64247407 missense probably damaging 1.00
R8544:Trpm1 UTSW 7 64224608 splice site probably null
R8813:Trpm1 UTSW 7 64202008 missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 64268880 missense probably benign 0.06
R8954:Trpm1 UTSW 7 64208341 missense probably damaging 0.98
R9139:Trpm1 UTSW 7 64199195 missense probably benign 0.00
R9205:Trpm1 UTSW 7 64240571 missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 64234965 missense probably benign 0.01
R9283:Trpm1 UTSW 7 64223875 missense probably benign 0.18
R9394:Trpm1 UTSW 7 64268732 missense probably benign 0.00
R9430:Trpm1 UTSW 7 64223698 missense probably benign 0.38
R9537:Trpm1 UTSW 7 64153868 unclassified probably benign
R9616:Trpm1 UTSW 7 64208384 missense probably damaging 0.99
R9774:Trpm1 UTSW 7 64248293 missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Z1176:Trpm1 UTSW 7 64203131 critical splice donor site probably null
Z1176:Trpm1 UTSW 7 64204594 critical splice donor site probably null
Z1177:Trpm1 UTSW 7 64217691 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCTTGCAAAGAGCTAAACGC -3'
(R):5'- TGGCCCATCAAGCAAGCATG -3'

Sequencing Primer
(F):5'- GCAGGCCAATTTTTAATGCTGC -3'
(R):5'- GCATGGCAGAGCTAGACAC -3'
Posted On 2015-07-21