Incidental Mutation 'R4490:Pgm3'
ID330686
Institutional Source Beutler Lab
Gene Symbol Pgm3
Ensembl Gene ENSMUSG00000056131
Gene Namephosphoglucomutase 3
SynonymsPgm-3, GlcNAc-P mutase, 2810473H05Rik
MMRRC Submission 041746-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R4490 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86554377-86571842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86561840 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 337 (Y337C)
Ref Sequence ENSEMBL: ENSMUSP00000072390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070064] [ENSMUST00000072585]
Predicted Effect probably damaging
Transcript: ENSMUST00000070064
AA Change: Y337C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070871
Gene: ENSMUSG00000056131
AA Change: Y337C

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 6.5e-9 PFAM
Pfam:PGM_PMM_I 96 174 4.3e-9 PFAM
Pfam:PGM_PMM_IV 443 528 8.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072585
AA Change: Y337C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072390
Gene: ENSMUSG00000056131
AA Change: Y337C

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 2.5e-10 PFAM
Pfam:PGM_PMM_I 95 175 3.6e-11 PFAM
Pfam:PGM_PMM_II 181 291 9.4e-14 PFAM
SCOP:d3pmga3 298 374 1e-8 SMART
Pfam:PGM_PMM_IV 383 487 8.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190924
Meta Mutation Damage Score 0.9727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphohexose mutase family. The encoded protein mediates both glycogen formation and utilization by catalyzing the interconversion of glucose-1-phosphate and glucose-6-phosphate. A non-synonymous single nucleotide polymorphism in this gene may play a role in resistance to diabetic nephropathy and neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility, anemia, leukopenia, thrombocytopenia, abnormal pancreatic and salivary gland morphology, and splenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,633,779 V417A probably damaging Het
Adgrb2 T C 4: 130,012,328 V881A possibly damaging Het
Arl5c G A 11: 97,995,836 R10* probably null Het
Atad1 A G 19: 32,695,797 C229R probably benign Het
Atp6v0a2 T C 5: 124,646,734 V319A probably damaging Het
Cage1 A G 13: 38,023,417 S257P possibly damaging Het
Ccndbp1 A G 2: 121,012,395 D179G probably damaging Het
Cngb3 T C 4: 19,415,684 I398T probably benign Het
Crmp1 A G 5: 37,276,331 D178G probably damaging Het
Csmd3 C T 15: 48,314,033 V370I possibly damaging Het
Dapk1 A G 13: 60,718,128 T180A probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
F5 T C 1: 164,217,395 V2084A probably benign Het
Fan1 A T 7: 64,369,180 S476T possibly damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Gbp2 A G 3: 142,623,764 N24S probably benign Het
Gm14325 T C 2: 177,832,983 H101R possibly damaging Het
Gpr55 C T 1: 85,941,818 V14M probably damaging Het
Herc6 A T 6: 57,654,495 Y724F probably damaging Het
Impg1 T A 9: 80,394,059 Q195L probably damaging Het
Inf2 T C 12: 112,600,204 F68L probably damaging Het
Kcnh8 T C 17: 52,961,877 probably null Het
Klb A G 5: 65,375,794 N482S probably benign Het
Kpnb1 A G 11: 97,171,598 V447A probably benign Het
Nckap5l G A 15: 99,426,130 P831S probably benign Het
Ncor2 A G 5: 125,036,815 probably null Het
Olfr32 A T 2: 90,138,917 V74D probably damaging Het
Prdm1 G T 10: 44,446,907 Y197* probably null Het
Prdm4 A T 10: 85,900,899 C626S probably damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ranbp6 A G 19: 29,810,333 L873P probably damaging Het
Rin2 A G 2: 145,822,274 T23A possibly damaging Het
Rxra G T 2: 27,741,195 R118L probably damaging Het
Spice1 T C 16: 44,382,113 L750P probably damaging Het
Trpm1 C T 7: 64,208,912 Q228* probably null Het
Tsc1 A G 2: 28,670,925 D265G probably damaging Het
Usp29 T C 7: 6,961,950 I264T possibly damaging Het
Vmn2r26 T C 6: 124,050,738 L479P possibly damaging Het
Zfp9 A G 6: 118,465,312 S130P probably benign Het
Other mutations in Pgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Pgm3 APN 9 86561879 missense probably damaging 0.96
IGL01865:Pgm3 APN 9 86555318 missense possibly damaging 0.85
IGL02800:Pgm3 APN 9 86555378 missense possibly damaging 0.94
R6592_Pgm3_648 UTSW 9 86559443 missense possibly damaging 0.87
R0038:Pgm3 UTSW 9 86564673 splice site probably benign
R0038:Pgm3 UTSW 9 86564673 splice site probably benign
R0266:Pgm3 UTSW 9 86567533 missense probably benign 0.00
R0536:Pgm3 UTSW 9 86567536 missense possibly damaging 0.83
R0617:Pgm3 UTSW 9 86556190 critical splice donor site probably null
R1499:Pgm3 UTSW 9 86570287 missense probably benign 0.01
R1780:Pgm3 UTSW 9 86556204 missense probably damaging 1.00
R1838:Pgm3 UTSW 9 86569233 missense probably benign 0.03
R1882:Pgm3 UTSW 9 86565690 missense possibly damaging 0.72
R1920:Pgm3 UTSW 9 86558478 missense possibly damaging 0.47
R2095:Pgm3 UTSW 9 86556341 missense probably damaging 0.99
R2378:Pgm3 UTSW 9 86562667 missense probably damaging 0.97
R2679:Pgm3 UTSW 9 86569321 missense probably benign 0.32
R3021:Pgm3 UTSW 9 86567535 missense possibly damaging 0.95
R3686:Pgm3 UTSW 9 86559510 missense probably benign 0.37
R4651:Pgm3 UTSW 9 86558470 missense probably benign 0.01
R4652:Pgm3 UTSW 9 86558470 missense probably benign 0.01
R4718:Pgm3 UTSW 9 86570395 missense probably benign 0.00
R4883:Pgm3 UTSW 9 86569325 missense probably damaging 1.00
R4940:Pgm3 UTSW 9 86559476 missense probably damaging 1.00
R4973:Pgm3 UTSW 9 86562679 missense probably benign
R4990:Pgm3 UTSW 9 86558412 missense probably damaging 0.97
R5357:Pgm3 UTSW 9 86556257 nonsense probably null
R5870:Pgm3 UTSW 9 86570361 missense probably damaging 0.99
R6592:Pgm3 UTSW 9 86559443 missense possibly damaging 0.87
R6807:Pgm3 UTSW 9 86556502 intron probably null
R7152:Pgm3 UTSW 9 86567540 missense probably benign 0.13
R7274:Pgm3 UTSW 9 86562597 missense probably damaging 1.00
X0028:Pgm3 UTSW 9 86569355 missense probably damaging 1.00
Z1088:Pgm3 UTSW 9 86564707 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATACTACGGCAAATGCTCCAAGG -3'
(R):5'- TTTTGCCTAAACCAAGCCAGG -3'

Sequencing Primer
(F):5'- CCTTTTGCACCAGAGATGTCAGAG -3'
(R):5'- CCAAGCCAGGGCAGAACTG -3'
Posted On2015-07-21