Incidental Mutation 'R0052:Slc9c1'
ID 33069
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 038346-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R0052 (G1)
Quality Score 160
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to G at 45427219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023339] [ENSMUST00000159945] [ENSMUST00000161347]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000023339
Predicted Effect unknown
Transcript: ENSMUST00000159945
AA Change: I1175V
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I1175V

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161347
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,893,315 (GRCm39) S438P possibly damaging Het
Atosa A G 9: 74,926,265 (GRCm39) probably benign Het
Atp2a1 A G 7: 126,057,069 (GRCm39) probably benign Het
Axin2 T C 11: 108,840,096 (GRCm39) Y735H probably damaging Het
Bicd2 T A 13: 49,528,790 (GRCm39) L184Q probably damaging Het
Bub1 G A 2: 127,650,959 (GRCm39) T618I probably benign Het
Catsperg2 A G 7: 29,424,445 (GRCm39) probably benign Het
Ccdc73 T A 2: 104,759,915 (GRCm39) probably benign Het
Crybg3 A T 16: 59,386,019 (GRCm39) probably benign Het
Dsp A G 13: 38,381,340 (GRCm39) D2096G possibly damaging Het
Eef2 C CN 10: 81,014,602 (GRCm39) probably null Het
Elp3 A G 14: 65,768,975 (GRCm39) *548Q probably null Het
Eno4 A G 19: 58,956,985 (GRCm39) D357G probably damaging Het
Fcrl2 A T 3: 87,164,085 (GRCm39) I348N possibly damaging Het
Fgl2 A T 5: 21,580,347 (GRCm39) S230C probably damaging Het
Ginm1 T A 10: 7,655,070 (GRCm39) E57D possibly damaging Het
Gtf3c1 A T 7: 125,267,143 (GRCm39) probably null Het
Herc1 G T 9: 66,307,438 (GRCm39) G1044V probably damaging Het
Hmcn1 G A 1: 150,553,157 (GRCm39) T2511M probably damaging Het
Iba57 C T 11: 59,049,727 (GRCm39) A207T probably benign Het
Itga9 T A 9: 118,465,617 (GRCm39) I157N probably damaging Het
Kalrn A G 16: 34,177,541 (GRCm39) L208P probably damaging Het
Kcnj10 A G 1: 172,196,491 (GRCm39) T2A probably benign Het
Kdm1b T A 13: 47,217,593 (GRCm39) C351S probably damaging Het
Kif21a T C 15: 90,855,060 (GRCm39) E700G probably damaging Het
Mmd C T 11: 90,150,824 (GRCm39) probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Morn3 T C 5: 123,184,726 (GRCm39) Y38C probably damaging Het
Nacc1 A T 8: 85,402,854 (GRCm39) V313D probably benign Het
Nbeal1 T A 1: 60,267,771 (GRCm39) probably benign Het
Neb T C 2: 52,163,992 (GRCm39) K1989E possibly damaging Het
Nlrp3 C T 11: 59,455,954 (GRCm39) R917* probably null Het
Nlrp4b T A 7: 10,459,889 (GRCm39) Y463* probably null Het
Perm1 A T 4: 156,302,572 (GRCm39) D372V probably damaging Het
Phf3 T C 1: 30,847,848 (GRCm39) T1232A probably damaging Het
Phldb3 G A 7: 24,312,004 (GRCm39) R106Q probably benign Het
Pld4 T A 12: 112,734,291 (GRCm39) F386I probably benign Het
Prex2 T A 1: 11,230,380 (GRCm39) L802Q probably damaging Het
Psd3 A G 8: 68,335,631 (GRCm39) probably null Het
Ralgds T A 2: 28,434,400 (GRCm39) probably null Het
Rmdn2 A G 17: 79,957,760 (GRCm39) E16G probably damaging Het
Rnf111 A T 9: 70,383,671 (GRCm39) S87R probably benign Het
Slc4a4 A C 5: 89,304,195 (GRCm39) H502P possibly damaging Het
Slco3a1 A T 7: 74,154,074 (GRCm39) I166N probably benign Het
Snx5 A T 2: 144,101,112 (GRCm39) probably null Het
Srgap1 T C 10: 121,636,732 (GRCm39) D741G possibly damaging Het
St8sia2 G T 7: 73,593,038 (GRCm39) Y339* probably null Het
St8sia2 A T 7: 73,621,700 (GRCm39) W86R probably damaging Het
Stk33 A G 7: 108,878,876 (GRCm39) L491P possibly damaging Het
Sult2a7 T C 7: 14,199,133 (GRCm39) Y298C probably damaging Het
Tdo2 T A 3: 81,874,332 (GRCm39) N210I probably benign Het
Thada A T 17: 84,762,586 (GRCm39) N104K probably damaging Het
Timm8b A T 9: 50,516,330 (GRCm39) D61V possibly damaging Het
Tshz1 G A 18: 84,033,070 (GRCm39) T446I possibly damaging Het
Ubap2l T C 3: 89,946,235 (GRCm39) N123S possibly damaging Het
Vmn1r48 T C 6: 90,013,246 (GRCm39) E193G possibly damaging Het
Vmn1r69 C T 7: 10,314,327 (GRCm39) V135I probably benign Het
Vmn2r103 G T 17: 20,031,903 (GRCm39) G559V probably benign Het
Vmn2r26 T A 6: 124,038,992 (GRCm39) *856R probably null Het
Vmn2r88 A G 14: 51,656,157 (GRCm39) I798V possibly damaging Het
Vsir C T 10: 60,193,861 (GRCm39) A108V probably benign Het
Zfp14 G T 7: 29,737,753 (GRCm39) Q411K probably damaging Het
Zfp236 A T 18: 82,657,457 (GRCm39) M762K probably damaging Het
Zfp462 G A 4: 55,011,762 (GRCm39) G1243S probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAAGATAACCCCTCAAAGCCCTGCC -3'
(R):5'- CCCACCCCAGTCTAAATACAGAAATAACATCA -3'

Sequencing Primer
(F):5'- gcgacagactacaacatcaac -3'
(R):5'- ATAACATCATTTGGAGAGTTGGTTG -3'
Posted On 2013-05-09