Incidental Mutation 'R0052:Slc9c1'
ID 33069
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, Slc9a10, spermNHE
MMRRC Submission 038346-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock # R0052 (G1)
Quality Score 160
Status Validated
Chromosome 16
Chromosomal Location 45535309-45607001 bp(+) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) A to G at 45606856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023339] [ENSMUST00000159945] [ENSMUST00000161347]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000023339
Predicted Effect unknown
Transcript: ENSMUST00000159945
AA Change: I1175V
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I1175V

Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161347
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,915,951 S438P possibly damaging Het
Atp2a1 A G 7: 126,457,897 probably benign Het
Axin2 T C 11: 108,949,270 Y735H probably damaging Het
Bicd2 T A 13: 49,375,314 L184Q probably damaging Het
Bub1 G A 2: 127,809,039 T618I probably benign Het
Catsperg2 A G 7: 29,725,020 probably benign Het
Ccdc73 T A 2: 104,929,570 probably benign Het
Crybg3 A T 16: 59,565,656 probably benign Het
Dsp A G 13: 38,197,364 D2096G possibly damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Elp3 A G 14: 65,531,526 *548Q probably null Het
Eno4 A G 19: 58,968,553 D357G probably damaging Het
Fam214a A G 9: 75,018,983 probably benign Het
Fcrls A T 3: 87,256,778 I348N possibly damaging Het
Fgl2 A T 5: 21,375,349 S230C probably damaging Het
Ginm1 T A 10: 7,779,306 E57D possibly damaging Het
Gtf3c1 A T 7: 125,667,971 probably null Het
Herc1 G T 9: 66,400,156 G1044V probably damaging Het
Hmcn1 G A 1: 150,677,406 T2511M probably damaging Het
Iba57 C T 11: 59,158,901 A207T probably benign Het
Itga9 T A 9: 118,636,549 I157N probably damaging Het
Kalrn A G 16: 34,357,171 L208P probably damaging Het
Kcnj10 A G 1: 172,368,924 T2A probably benign Het
Kdm1b T A 13: 47,064,117 C351S probably damaging Het
Kif21a T C 15: 90,970,857 E700G probably damaging Het
Mmd C T 11: 90,259,998 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Morn3 T C 5: 123,046,663 Y38C probably damaging Het
Nacc1 A T 8: 84,676,225 V313D probably benign Het
Nbeal1 T A 1: 60,228,612 probably benign Het
Neb T C 2: 52,273,980 K1989E possibly damaging Het
Nlrp3 C T 11: 59,565,128 R917* probably null Het
Nlrp4b T A 7: 10,725,962 Y463* probably null Het
Perm1 A T 4: 156,218,115 D372V probably damaging Het
Phf3 T C 1: 30,808,767 T1232A probably damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pld4 T A 12: 112,767,857 F386I probably benign Het
Prex2 T A 1: 11,160,156 L802Q probably damaging Het
Psd3 A G 8: 67,882,979 probably null Het
Ralgds T A 2: 28,544,388 probably null Het
Rmdn2 A G 17: 79,650,331 E16G probably damaging Het
Rnf111 A T 9: 70,476,389 S87R probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slco3a1 A T 7: 74,504,326 I166N probably benign Het
Snx5 A T 2: 144,259,192 probably null Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
St8sia2 G T 7: 73,943,290 Y339* probably null Het
St8sia2 A T 7: 73,971,952 W86R probably damaging Het
Stk33 A G 7: 109,279,669 L491P possibly damaging Het
Sult2a7 T C 7: 14,465,208 Y298C probably damaging Het
Tdo2 T A 3: 81,967,025 N210I probably benign Het
Thada A T 17: 84,455,158 N104K probably damaging Het
Timm8b A T 9: 50,605,030 D61V possibly damaging Het
Tshz1 G A 18: 84,014,945 T446I possibly damaging Het
Ubap2l T C 3: 90,038,928 N123S possibly damaging Het
Vmn1r48 T C 6: 90,036,264 E193G possibly damaging Het
Vmn1r69 C T 7: 10,580,400 V135I probably benign Het
Vmn2r103 G T 17: 19,811,641 G559V probably benign Het
Vmn2r26 T A 6: 124,062,033 *856R probably null Het
Vmn2r88 A G 14: 51,418,700 I798V possibly damaging Het
Vsir C T 10: 60,358,082 A108V probably benign Het
Zfp14 G T 7: 30,038,328 Q411K probably damaging Het
Zfp236 A T 18: 82,639,332 M762K probably damaging Het
Zfp462 G A 4: 55,011,762 G1243S probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45580127 missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45599781 missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45577912 missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45550188 missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45593485 missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45575407 missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45560342 missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45580214 missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45547663 missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45580253 missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gcgacagactacaacatcaac -3'
Posted On 2013-05-09