Incidental Mutation 'R4490:Kpnb1'
ID 330690
Institutional Source Beutler Lab
Gene Symbol Kpnb1
Ensembl Gene ENSMUSG00000001440
Gene Name karyopherin subunit beta 1
Synonyms Impnb
MMRRC Submission 041746-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4490 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 97050540-97078707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97062424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 447 (V447A)
Ref Sequence ENSEMBL: ENSMUSP00000001479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001479]
AlphaFold P70168
PDB Structure N-TERMINAL FRAGMENT OF IMPORTIN-BETA [X-RAY DIFFRACTION]
Crystal structure of Importin-beta and SREBP-2 complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000001479
AA Change: V447A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001479
Gene: ENSMUSG00000001440
AA Change: V447A

DomainStartEndE-ValueType
IBN_N 21 101 3.72e-5 SMART
Blast:ARM 158 203 4e-7 BLAST
Pfam:HEAT_EZ 380 435 3e-13 PFAM
Pfam:HEAT 409 439 2.6e-7 PFAM
Blast:ARM 440 477 7e-17 BLAST
low complexity region 478 495 N/A INTRINSIC
Blast:IBN_N 528 590 9e-25 BLAST
Blast:ARM 594 637 1e-18 BLAST
Blast:ARM 784 827 1e-5 BLAST
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,461,349 (GRCm39) V417A probably damaging Het
Adgrb2 T C 4: 129,906,121 (GRCm39) V881A possibly damaging Het
Arl5c G A 11: 97,886,662 (GRCm39) R10* probably null Het
Atad1 A G 19: 32,673,197 (GRCm39) C229R probably benign Het
Atp6v0a2 T C 5: 124,784,674 (GRCm39) V319A probably damaging Het
Cage1 A G 13: 38,207,393 (GRCm39) S257P possibly damaging Het
Ccndbp1 A G 2: 120,842,876 (GRCm39) D179G probably damaging Het
Cngb3 T C 4: 19,415,684 (GRCm39) I398T probably benign Het
Crmp1 A G 5: 37,433,675 (GRCm39) D178G probably damaging Het
Csmd3 C T 15: 48,177,429 (GRCm39) V370I possibly damaging Het
Dapk1 A G 13: 60,865,942 (GRCm39) T180A probably benign Het
Dmtf1 A G 5: 9,190,379 (GRCm39) probably benign Het
Dnah12 T C 14: 26,455,758 (GRCm39) L827S possibly damaging Het
F5 T C 1: 164,044,964 (GRCm39) V2084A probably benign Het
Fan1 A T 7: 64,018,928 (GRCm39) S476T possibly damaging Het
Far2 T C 6: 148,074,907 (GRCm39) L380P possibly damaging Het
Gbp2 A G 3: 142,329,525 (GRCm39) N24S probably benign Het
Gm14325 T C 2: 177,474,776 (GRCm39) H101R possibly damaging Het
Gpr55 C T 1: 85,869,540 (GRCm39) V14M probably damaging Het
Herc6 A T 6: 57,631,480 (GRCm39) Y724F probably damaging Het
Impg1 T A 9: 80,301,341 (GRCm39) Q195L probably damaging Het
Inf2 T C 12: 112,566,638 (GRCm39) F68L probably damaging Het
Kcnh8 T C 17: 53,268,905 (GRCm39) probably null Het
Klb A G 5: 65,533,137 (GRCm39) N482S probably benign Het
Nckap5l G A 15: 99,324,011 (GRCm39) P831S probably benign Het
Ncor2 A G 5: 125,113,879 (GRCm39) probably null Het
Or4b1d A T 2: 89,969,261 (GRCm39) V74D probably damaging Het
Pgm3 T C 9: 86,443,893 (GRCm39) Y337C probably damaging Het
Prdm1 G T 10: 44,322,903 (GRCm39) Y197* probably null Het
Prdm4 A T 10: 85,736,763 (GRCm39) C626S probably damaging Het
Prex2 T A 1: 11,232,487 (GRCm39) S851R probably benign Het
Ranbp6 A G 19: 29,787,733 (GRCm39) L873P probably damaging Het
Rin2 A G 2: 145,664,194 (GRCm39) T23A possibly damaging Het
Rxra G T 2: 27,631,207 (GRCm39) R118L probably damaging Het
Spice1 T C 16: 44,202,476 (GRCm39) L750P probably damaging Het
Trpm1 C T 7: 63,858,660 (GRCm39) Q228* probably null Het
Tsc1 A G 2: 28,560,937 (GRCm39) D265G probably damaging Het
Usp29 T C 7: 6,964,949 (GRCm39) I264T possibly damaging Het
Vmn2r26 T C 6: 124,027,697 (GRCm39) L479P possibly damaging Het
Zfp9 A G 6: 118,442,273 (GRCm39) S130P probably benign Het
Other mutations in Kpnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Kpnb1 APN 11 97,056,928 (GRCm39) missense probably damaging 1.00
IGL01919:Kpnb1 APN 11 97,055,556 (GRCm39) missense probably benign
IGL02161:Kpnb1 APN 11 97,059,762 (GRCm39) missense probably benign 0.01
IGL02679:Kpnb1 APN 11 97,068,086 (GRCm39) missense possibly damaging 0.92
IGL02866:Kpnb1 APN 11 97,068,112 (GRCm39) missense probably damaging 0.99
IGL02899:Kpnb1 APN 11 97,066,612 (GRCm39) missense probably damaging 1.00
R0373:Kpnb1 UTSW 11 97,075,916 (GRCm39) missense probably damaging 1.00
R0542:Kpnb1 UTSW 11 97,078,398 (GRCm39) missense probably benign 0.12
R0724:Kpnb1 UTSW 11 97,069,130 (GRCm39) missense probably damaging 1.00
R0825:Kpnb1 UTSW 11 97,062,501 (GRCm39) missense probably damaging 0.98
R0853:Kpnb1 UTSW 11 97,078,237 (GRCm39) missense probably damaging 0.97
R1481:Kpnb1 UTSW 11 97,069,136 (GRCm39) missense probably damaging 1.00
R3802:Kpnb1 UTSW 11 97,056,955 (GRCm39) missense possibly damaging 0.92
R4458:Kpnb1 UTSW 11 97,059,996 (GRCm39) missense probably damaging 1.00
R4757:Kpnb1 UTSW 11 97,068,160 (GRCm39) missense possibly damaging 0.65
R5500:Kpnb1 UTSW 11 97,063,937 (GRCm39) missense possibly damaging 0.94
R6360:Kpnb1 UTSW 11 97,064,096 (GRCm39) missense probably benign
R6494:Kpnb1 UTSW 11 97,072,474 (GRCm39) missense probably benign 0.04
R7678:Kpnb1 UTSW 11 97,059,999 (GRCm39) missense probably damaging 1.00
R8171:Kpnb1 UTSW 11 97,066,573 (GRCm39) critical splice donor site probably null
R8874:Kpnb1 UTSW 11 97,056,209 (GRCm39) missense probably benign 0.25
R9318:Kpnb1 UTSW 11 97,054,284 (GRCm39) missense probably benign
R9621:Kpnb1 UTSW 11 97,058,460 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGCACGCCTTTCAATGAGAC -3'
(R):5'- TCTATCATTATATGGGGCCAGGG -3'

Sequencing Primer
(F):5'- ATGAGACAAGTAACCTTTCTCTCC -3'
(R):5'- TTAGATCCCAAGTGCTGCAG -3'
Posted On 2015-07-21