Incidental Mutation 'R4490:Arl5c'
ID330691
Institutional Source Beutler Lab
Gene Symbol Arl5c
Ensembl Gene ENSMUSG00000038352
Gene NameADP-ribosylation factor-like 5C
SynonymsArl12
MMRRC Submission 041746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4490 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location97989578-97996181 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 97995836 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 10 (R10*)
Ref Sequence ENSEMBL: ENSMUSP00000103188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042971] [ENSMUST00000107563]
Predicted Effect probably null
Transcript: ENSMUST00000042971
AA Change: R10*
SMART Domains Protein: ENSMUSP00000037214
Gene: ENSMUSG00000038352
AA Change: R10*

DomainStartEndE-ValueType
ARF 1 179 3.96e-59 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107563
AA Change: R10*
SMART Domains Protein: ENSMUSP00000103188
Gene: ENSMUSG00000038352
AA Change: R10*

DomainStartEndE-ValueType
Pfam:Arf 1 86 2.6e-29 PFAM
Pfam:SRPRB 14 88 9.1e-10 PFAM
Pfam:Miro 18 86 4e-8 PFAM
Pfam:Gtr1_RagA 18 87 7.5e-8 PFAM
Pfam:Ras 18 87 2.1e-10 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,633,779 V417A probably damaging Het
Adgrb2 T C 4: 130,012,328 V881A possibly damaging Het
Atad1 A G 19: 32,695,797 C229R probably benign Het
Atp6v0a2 T C 5: 124,646,734 V319A probably damaging Het
Cage1 A G 13: 38,023,417 S257P possibly damaging Het
Ccndbp1 A G 2: 121,012,395 D179G probably damaging Het
Cngb3 T C 4: 19,415,684 I398T probably benign Het
Crmp1 A G 5: 37,276,331 D178G probably damaging Het
Csmd3 C T 15: 48,314,033 V370I possibly damaging Het
Dapk1 A G 13: 60,718,128 T180A probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
F5 T C 1: 164,217,395 V2084A probably benign Het
Fan1 A T 7: 64,369,180 S476T possibly damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Gbp2 A G 3: 142,623,764 N24S probably benign Het
Gm14325 T C 2: 177,832,983 H101R possibly damaging Het
Gpr55 C T 1: 85,941,818 V14M probably damaging Het
Herc6 A T 6: 57,654,495 Y724F probably damaging Het
Impg1 T A 9: 80,394,059 Q195L probably damaging Het
Inf2 T C 12: 112,600,204 F68L probably damaging Het
Kcnh8 T C 17: 52,961,877 probably null Het
Klb A G 5: 65,375,794 N482S probably benign Het
Kpnb1 A G 11: 97,171,598 V447A probably benign Het
Nckap5l G A 15: 99,426,130 P831S probably benign Het
Ncor2 A G 5: 125,036,815 probably null Het
Olfr32 A T 2: 90,138,917 V74D probably damaging Het
Pgm3 T C 9: 86,561,840 Y337C probably damaging Het
Prdm1 G T 10: 44,446,907 Y197* probably null Het
Prdm4 A T 10: 85,900,899 C626S probably damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ranbp6 A G 19: 29,810,333 L873P probably damaging Het
Rin2 A G 2: 145,822,274 T23A possibly damaging Het
Rxra G T 2: 27,741,195 R118L probably damaging Het
Spice1 T C 16: 44,382,113 L750P probably damaging Het
Trpm1 C T 7: 64,208,912 Q228* probably null Het
Tsc1 A G 2: 28,670,925 D265G probably damaging Het
Usp29 T C 7: 6,961,950 I264T possibly damaging Het
Vmn2r26 T C 6: 124,050,738 L479P possibly damaging Het
Zfp9 A G 6: 118,465,312 S130P probably benign Het
Other mutations in Arl5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0402:Arl5c UTSW 11 97995113 missense probably damaging 1.00
R1570:Arl5c UTSW 11 97992387 missense probably benign 0.11
R2095:Arl5c UTSW 11 97993451 missense probably damaging 1.00
R2960:Arl5c UTSW 11 97995076 missense probably damaging 1.00
R3151:Arl5c UTSW 11 97992333 missense probably damaging 0.96
R4078:Arl5c UTSW 11 97993501 missense probably damaging 1.00
R4079:Arl5c UTSW 11 97993501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGGTCCGAAGCACACTG -3'
(R):5'- TACCTAGTCTTCGTGGTGACGC -3'

Sequencing Primer
(F):5'- TGGGCTCTAAATCACAATCTCAGG -3'
(R):5'- TGGTGACGCCACTCAGAC -3'
Posted On2015-07-21