Mutagenetix > Incidental Mutations

Incidental Mutation 'R4490:Spice1'

330697

Institutional Source

Beutler Lab

Gene Symbol

Spice1

Ensembl Gene

ENSMUSG00000043065

Gene Name

spindle and centriole associated protein 1

Synonyms

Ccdc52, D16Ertd480e

MMRRC Submission

041746-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4490 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44347121-44388497 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44382113 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 750 (L750P)

Ref Sequence

ENSEMBL: ENSMUSP00000058832 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050897]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050897
AA Change: L750P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058832
Gene: ENSMUSG00000043065
AA Change: L750P

Domain	Start	End	E-Value	Type
Pfam:SPICE	33	436	1.4e-151	PFAM
low complexity region	627	642	N/A	INTRINSIC
coiled coil region	729	757	N/A	INTRINSIC
low complexity region	758	775	N/A	INTRINSIC
low complexity region	804	824	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126228

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133168

Meta Mutation Damage Score

0.6321

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (45/45)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl2	T	C	1: 156,633,779	V417A	probably damaging	Het
Adgrb2	T	C	4: 130,012,328	V881A	possibly damaging	Het
Arl5c	G	A	11: 97,995,836	R10*	probably null	Het
Atad1	A	G	19: 32,695,797	C229R	probably benign	Het
Atp6v0a2	T	C	5: 124,646,734	V319A	probably damaging	Het
Cage1	A	G	13: 38,023,417	S257P	possibly damaging	Het
Ccndbp1	A	G	2: 121,012,395	D179G	probably damaging	Het
Cngb3	T	C	4: 19,415,684	I398T	probably benign	Het
Crmp1	A	G	5: 37,276,331	D178G	probably damaging	Het
Csmd3	C	T	15: 48,314,033	V370I	possibly damaging	Het
Dapk1	A	G	13: 60,718,128	T180A	probably benign	Het
Dmtf1	A	G	5: 9,140,379		probably benign	Het
Dnah12	T	C	14: 26,734,603	L827S	possibly damaging	Het
F5	T	C	1: 164,217,395	V2084A	probably benign	Het
Fan1	A	T	7: 64,369,180	S476T	possibly damaging	Het
Far2	T	C	6: 148,173,409	L380P	possibly damaging	Het
Gbp2	A	G	3: 142,623,764	N24S	probably benign	Het
Gm14325	T	C	2: 177,832,983	H101R	possibly damaging	Het
Gpr55	C	T	1: 85,941,818	V14M	probably damaging	Het
Herc6	A	T	6: 57,654,495	Y724F	probably damaging	Het
Impg1	T	A	9: 80,394,059	Q195L	probably damaging	Het
Inf2	T	C	12: 112,600,204	F68L	probably damaging	Het
Kcnh8	T	C	17: 52,961,877		probably null	Het
Klb	A	G	5: 65,375,794	N482S	probably benign	Het
Kpnb1	A	G	11: 97,171,598	V447A	probably benign	Het
Nckap5l	G	A	15: 99,426,130	P831S	probably benign	Het
Ncor2	A	G	5: 125,036,815		probably null	Het
Olfr32	A	T	2: 90,138,917	V74D	probably damaging	Het
Pgm3	T	C	9: 86,561,840	Y337C	probably damaging	Het
Prdm1	G	T	10: 44,446,907	Y197*	probably null	Het
Prdm4	A	T	10: 85,900,899	C626S	probably damaging	Het
Prex2	T	A	1: 11,162,263	S851R	probably benign	Het
Ranbp6	A	G	19: 29,810,333	L873P	probably damaging	Het
Rin2	A	G	2: 145,822,274	T23A	possibly damaging	Het
Rxra	G	T	2: 27,741,195	R118L	probably damaging	Het
Trpm1	C	T	7: 64,208,912	Q228*	probably null	Het
Tsc1	A	G	2: 28,670,925	D265G	probably damaging	Het
Usp29	T	C	7: 6,961,950	I264T	possibly damaging	Het
Vmn2r26	T	C	6: 124,050,738	L479P	possibly damaging	Het
Zfp9	A	G	6: 118,465,312	S130P	probably benign	Het

Other mutations in Spice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01393:Spice1	APN	16	44366630	missense	probably benign	0.20
IGL01688:Spice1	APN	16	44384710	missense	probably benign	0.04
IGL03259:Spice1	APN	16	44356167	missense	probably damaging	1.00
IGL03367:Spice1	APN	16	44356178	missense	probably damaging	0.99
R0230:Spice1	UTSW	16	44365576	splice site	probably benign
R0944:Spice1	UTSW	16	44384761	missense	probably benign
R1352:Spice1	UTSW	16	44386822	missense	probably damaging	1.00
R1888:Spice1	UTSW	16	44365626	missense	probably damaging	1.00
R1888:Spice1	UTSW	16	44365626	missense	probably damaging	1.00
R1894:Spice1	UTSW	16	44365626	missense	probably damaging	1.00
R1907:Spice1	UTSW	16	44357830	nonsense	probably null
R2404:Spice1	UTSW	16	44366626	missense	probably benign	0.29
R2444:Spice1	UTSW	16	44366568	nonsense	probably null
R3551:Spice1	UTSW	16	44357869	missense	probably damaging	0.96
R3848:Spice1	UTSW	16	44378891	nonsense	probably null
R3857:Spice1	UTSW	16	44355443	missense	probably damaging	1.00
R5593:Spice1	UTSW	16	44370752	missense	possibly damaging	0.50
R5996:Spice1	UTSW	16	44384674	missense	probably benign	0.00
R6303:Spice1	UTSW	16	44370697	missense	probably benign	0.03
R6552:Spice1	UTSW	16	44379033	missense	possibly damaging	0.75
R7042:Spice1	UTSW	16	44385680	missense	probably benign	0.04
R7062:Spice1	UTSW	16	44357896	missense	probably damaging	1.00
R7065:Spice1	UTSW	16	44355535	missense	probably damaging	1.00
R7115:Spice1	UTSW	16	44379275	missense	probably benign	0.00
R7762:Spice1	UTSW	16	44370501	splice site	probably null
R8408:Spice1	UTSW	16	44384697	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCCTCATGCTTCAATTACATG -3'
(R):5'- GTTGACTCAGCAGGAACTTTCAC -3'

Sequencing Primer
(F):5'- GGCTCATAAATACTGAATTGCTGG -3'
(R):5'- CTCAGCAGGAACTTTCACAGTTGG -3'

Posted On

2015-07-21