Incidental Mutation 'R4490:Spice1'
ID330697
Institutional Source Beutler Lab
Gene Symbol Spice1
Ensembl Gene ENSMUSG00000043065
Gene Namespindle and centriole associated protein 1
SynonymsCcdc52, D16Ertd480e
MMRRC Submission 041746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4490 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44347121-44388497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44382113 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 750 (L750P)
Ref Sequence ENSEMBL: ENSMUSP00000058832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050897]
Predicted Effect probably damaging
Transcript: ENSMUST00000050897
AA Change: L750P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058832
Gene: ENSMUSG00000043065
AA Change: L750P

DomainStartEndE-ValueType
Pfam:SPICE 33 436 1.4e-151 PFAM
low complexity region 627 642 N/A INTRINSIC
coiled coil region 729 757 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 804 824 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133168
Meta Mutation Damage Score 0.6321 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,633,779 V417A probably damaging Het
Adgrb2 T C 4: 130,012,328 V881A possibly damaging Het
Arl5c G A 11: 97,995,836 R10* probably null Het
Atad1 A G 19: 32,695,797 C229R probably benign Het
Atp6v0a2 T C 5: 124,646,734 V319A probably damaging Het
Cage1 A G 13: 38,023,417 S257P possibly damaging Het
Ccndbp1 A G 2: 121,012,395 D179G probably damaging Het
Cngb3 T C 4: 19,415,684 I398T probably benign Het
Crmp1 A G 5: 37,276,331 D178G probably damaging Het
Csmd3 C T 15: 48,314,033 V370I possibly damaging Het
Dapk1 A G 13: 60,718,128 T180A probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
F5 T C 1: 164,217,395 V2084A probably benign Het
Fan1 A T 7: 64,369,180 S476T possibly damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Gbp2 A G 3: 142,623,764 N24S probably benign Het
Gm14325 T C 2: 177,832,983 H101R possibly damaging Het
Gpr55 C T 1: 85,941,818 V14M probably damaging Het
Herc6 A T 6: 57,654,495 Y724F probably damaging Het
Impg1 T A 9: 80,394,059 Q195L probably damaging Het
Inf2 T C 12: 112,600,204 F68L probably damaging Het
Kcnh8 T C 17: 52,961,877 probably null Het
Klb A G 5: 65,375,794 N482S probably benign Het
Kpnb1 A G 11: 97,171,598 V447A probably benign Het
Nckap5l G A 15: 99,426,130 P831S probably benign Het
Ncor2 A G 5: 125,036,815 probably null Het
Olfr32 A T 2: 90,138,917 V74D probably damaging Het
Pgm3 T C 9: 86,561,840 Y337C probably damaging Het
Prdm1 G T 10: 44,446,907 Y197* probably null Het
Prdm4 A T 10: 85,900,899 C626S probably damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ranbp6 A G 19: 29,810,333 L873P probably damaging Het
Rin2 A G 2: 145,822,274 T23A possibly damaging Het
Rxra G T 2: 27,741,195 R118L probably damaging Het
Trpm1 C T 7: 64,208,912 Q228* probably null Het
Tsc1 A G 2: 28,670,925 D265G probably damaging Het
Usp29 T C 7: 6,961,950 I264T possibly damaging Het
Vmn2r26 T C 6: 124,050,738 L479P possibly damaging Het
Zfp9 A G 6: 118,465,312 S130P probably benign Het
Other mutations in Spice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Spice1 APN 16 44366630 missense probably benign 0.20
IGL01688:Spice1 APN 16 44384710 missense probably benign 0.04
IGL03259:Spice1 APN 16 44356167 missense probably damaging 1.00
IGL03367:Spice1 APN 16 44356178 missense probably damaging 0.99
R0230:Spice1 UTSW 16 44365576 splice site probably benign
R0944:Spice1 UTSW 16 44384761 missense probably benign
R1352:Spice1 UTSW 16 44386822 missense probably damaging 1.00
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1894:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1907:Spice1 UTSW 16 44357830 nonsense probably null
R2404:Spice1 UTSW 16 44366626 missense probably benign 0.29
R2444:Spice1 UTSW 16 44366568 nonsense probably null
R3551:Spice1 UTSW 16 44357869 missense probably damaging 0.96
R3848:Spice1 UTSW 16 44378891 nonsense probably null
R3857:Spice1 UTSW 16 44355443 missense probably damaging 1.00
R5593:Spice1 UTSW 16 44370752 missense possibly damaging 0.50
R5996:Spice1 UTSW 16 44384674 missense probably benign 0.00
R6303:Spice1 UTSW 16 44370697 missense probably benign 0.03
R6552:Spice1 UTSW 16 44379033 missense possibly damaging 0.75
R7042:Spice1 UTSW 16 44385680 missense probably benign 0.04
R7062:Spice1 UTSW 16 44357896 missense probably damaging 1.00
R7065:Spice1 UTSW 16 44355535 missense probably damaging 1.00
R7115:Spice1 UTSW 16 44379275 missense probably benign 0.00
R7762:Spice1 UTSW 16 44370501 splice site probably null
R8408:Spice1 UTSW 16 44384697 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCTCATGCTTCAATTACATG -3'
(R):5'- GTTGACTCAGCAGGAACTTTCAC -3'

Sequencing Primer
(F):5'- GGCTCATAAATACTGAATTGCTGG -3'
(R):5'- CTCAGCAGGAACTTTCACAGTTGG -3'
Posted On2015-07-21