Incidental Mutation 'R4490:Ranbp6'
ID330699
Institutional Source Beutler Lab
Gene Symbol Ranbp6
Ensembl Gene ENSMUSG00000074909
Gene NameRAN binding protein 6
Synonyms
MMRRC Submission 041746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R4490 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29808400-29812974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29810333 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 873 (L873P)
Ref Sequence ENSEMBL: ENSMUSP00000100503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099525] [ENSMUST00000177155]
Predicted Effect probably damaging
Transcript: ENSMUST00000099525
AA Change: L873P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100503
Gene: ENSMUSG00000074909
AA Change: L873P

DomainStartEndE-ValueType
low complexity region 70 78 N/A INTRINSIC
Pfam:HEAT_2 367 475 2.4e-12 PFAM
Pfam:HEAT_EZ 380 434 1.1e-9 PFAM
Pfam:HEAT 409 438 8.3e-7 PFAM
Pfam:HEAT 916 944 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175726
Predicted Effect probably benign
Transcript: ENSMUST00000177155
SMART Domains Protein: ENSMUSP00000135473
Gene: ENSMUSG00000046138

DomainStartEndE-ValueType
low complexity region 4 66 N/A INTRINSIC
BROMO 75 198 1.22e-3 SMART
low complexity region 205 219 N/A INTRINSIC
low complexity region 280 298 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
coiled coil region 606 638 N/A INTRINSIC
low complexity region 655 689 N/A INTRINSIC
coiled coil region 697 729 N/A INTRINSIC
low complexity region 1079 1093 N/A INTRINSIC
internal_repeat_1 1097 1226 1.32e-7 PROSPERO
low complexity region 1228 1237 N/A INTRINSIC
low complexity region 1319 1348 N/A INTRINSIC
low complexity region 1401 1416 N/A INTRINSIC
low complexity region 1535 1557 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1665 1678 N/A INTRINSIC
internal_repeat_1 1699 1843 1.32e-7 PROSPERO
low complexity region 1920 1926 N/A INTRINSIC
low complexity region 1946 1960 N/A INTRINSIC
low complexity region 1986 2004 N/A INTRINSIC
Meta Mutation Damage Score 0.7759 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,633,779 V417A probably damaging Het
Adgrb2 T C 4: 130,012,328 V881A possibly damaging Het
Arl5c G A 11: 97,995,836 R10* probably null Het
Atad1 A G 19: 32,695,797 C229R probably benign Het
Atp6v0a2 T C 5: 124,646,734 V319A probably damaging Het
Cage1 A G 13: 38,023,417 S257P possibly damaging Het
Ccndbp1 A G 2: 121,012,395 D179G probably damaging Het
Cngb3 T C 4: 19,415,684 I398T probably benign Het
Crmp1 A G 5: 37,276,331 D178G probably damaging Het
Csmd3 C T 15: 48,314,033 V370I possibly damaging Het
Dapk1 A G 13: 60,718,128 T180A probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
F5 T C 1: 164,217,395 V2084A probably benign Het
Fan1 A T 7: 64,369,180 S476T possibly damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Gbp2 A G 3: 142,623,764 N24S probably benign Het
Gm14325 T C 2: 177,832,983 H101R possibly damaging Het
Gpr55 C T 1: 85,941,818 V14M probably damaging Het
Herc6 A T 6: 57,654,495 Y724F probably damaging Het
Impg1 T A 9: 80,394,059 Q195L probably damaging Het
Inf2 T C 12: 112,600,204 F68L probably damaging Het
Kcnh8 T C 17: 52,961,877 probably null Het
Klb A G 5: 65,375,794 N482S probably benign Het
Kpnb1 A G 11: 97,171,598 V447A probably benign Het
Nckap5l G A 15: 99,426,130 P831S probably benign Het
Ncor2 A G 5: 125,036,815 probably null Het
Olfr32 A T 2: 90,138,917 V74D probably damaging Het
Pgm3 T C 9: 86,561,840 Y337C probably damaging Het
Prdm1 G T 10: 44,446,907 Y197* probably null Het
Prdm4 A T 10: 85,900,899 C626S probably damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rin2 A G 2: 145,822,274 T23A possibly damaging Het
Rxra G T 2: 27,741,195 R118L probably damaging Het
Spice1 T C 16: 44,382,113 L750P probably damaging Het
Trpm1 C T 7: 64,208,912 Q228* probably null Het
Tsc1 A G 2: 28,670,925 D265G probably damaging Het
Usp29 T C 7: 6,961,950 I264T possibly damaging Het
Vmn2r26 T C 6: 124,050,738 L479P possibly damaging Het
Zfp9 A G 6: 118,465,312 S130P probably benign Het
Other mutations in Ranbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Ranbp6 APN 19 29809776 missense probably benign 0.00
IGL02665:Ranbp6 APN 19 29812901 missense possibly damaging 0.64
IGL02943:Ranbp6 APN 19 29812124 missense possibly damaging 0.91
IGL03018:Ranbp6 APN 19 29811389 missense probably damaging 1.00
IGL03219:Ranbp6 APN 19 29810280 missense probably damaging 1.00
R0137:Ranbp6 UTSW 19 29809697 missense probably benign 0.16
R0412:Ranbp6 UTSW 19 29812083 missense possibly damaging 0.91
R1171:Ranbp6 UTSW 19 29812279 missense probably benign 0.37
R1521:Ranbp6 UTSW 19 29811446 missense probably benign
R1967:Ranbp6 UTSW 19 29812500 nonsense probably null
R2257:Ranbp6 UTSW 19 29811549 missense possibly damaging 0.47
R4624:Ranbp6 UTSW 19 29810863 nonsense probably null
R4625:Ranbp6 UTSW 19 29810863 nonsense probably null
R4626:Ranbp6 UTSW 19 29810863 nonsense probably null
R4649:Ranbp6 UTSW 19 29810321 missense probably benign 0.23
R4709:Ranbp6 UTSW 19 29811584 missense probably benign 0.00
R4777:Ranbp6 UTSW 19 29811637 missense probably damaging 1.00
R4895:Ranbp6 UTSW 19 29809775 missense possibly damaging 0.93
R5362:Ranbp6 UTSW 19 29811728 missense probably benign 0.30
R5379:Ranbp6 UTSW 19 29811683 missense probably damaging 1.00
R5617:Ranbp6 UTSW 19 29812463 missense probably damaging 1.00
R6264:Ranbp6 UTSW 19 29812626 missense probably benign 0.00
R7091:Ranbp6 UTSW 19 29812716 missense probably damaging 1.00
R7234:Ranbp6 UTSW 19 29812062 missense possibly damaging 0.67
R7664:Ranbp6 UTSW 19 29812076 missense possibly damaging 0.90
R7904:Ranbp6 UTSW 19 29812413 missense probably benign
R8023:Ranbp6 UTSW 19 29811822 missense possibly damaging 0.81
X0024:Ranbp6 UTSW 19 29812440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTGTCTGACTTCAGGG -3'
(R):5'- GCCTCAACGATGAACACTTGG -3'

Sequencing Primer
(F):5'- GTTGTTGTCTCGCATATTGAGAAGC -3'
(R):5'- CTTGAAGGGCACTTTAAAAACCAAG -3'
Posted On2015-07-21