Incidental Mutation 'R4491:Mc3r'
ID330708
Institutional Source Beutler Lab
Gene Symbol Mc3r
Ensembl Gene ENSMUSG00000038537
Gene Namemelanocortin 3 receptor
Synonyms
MMRRC Submission 041747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4491 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172248492-172251114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172249203 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 115 (H115R)
Ref Sequence ENSEMBL: ENSMUSP00000047358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038532
AA Change: H115R

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047358
Gene: ENSMUSG00000038537
AA Change: H115R

DomainStartEndE-ValueType
Pfam:7tm_4 45 198 3.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 49 314 1.9e-7 PFAM
Pfam:7tm_1 55 299 5.4e-35 PFAM
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis and adaptation to food restriction. Disruption of this gene results in an increased ratio of weight gain to food intake, increased fat mass, and decreased lean mass, without having a large effect on insulin sensitivity or glucose metabolism. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele exhibit obesity, increased respiratory quotient on a high fat diet, and reduced energy expenditure. Homozygotes for another null allele show reduced lean mass, increased fat mass, diet-induced obesity, increased insulin and leptin levels, and reduced energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cdhr5 T C 7: 141,274,057 N173D possibly damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fgd5 A G 6: 91,989,299 I680V possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Olfr683 A T 7: 105,143,776 C172* probably null Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rptn A T 3: 93,396,511 R384* probably null Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Taf15 A T 11: 83,484,694 T31S probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Wdr78 T C 4: 103,066,399 E411G probably benign Het
Zfp37 T C 4: 62,192,128 Q274R probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Mc3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Mc3r APN 2 172249028 missense possibly damaging 0.95
IGL01618:Mc3r APN 2 172249370 missense probably benign
IGL01784:Mc3r APN 2 172249370 missense probably benign
IGL01865:Mc3r APN 2 172249055 missense probably damaging 1.00
IGL02164:Mc3r APN 2 172249394 missense probably damaging 1.00
IGL03011:Mc3r APN 2 172249796 missense probably benign 0.08
IGL03266:Mc3r APN 2 172249269 missense probably benign 0.01
R0882:Mc3r UTSW 2 172249791 missense probably benign 0.00
R1005:Mc3r UTSW 2 172249563 missense probably benign 0.00
R1501:Mc3r UTSW 2 172249380 missense probably benign 0.19
R2374:Mc3r UTSW 2 172249154 missense possibly damaging 0.84
R3437:Mc3r UTSW 2 172249668 missense probably benign 0.23
R3813:Mc3r UTSW 2 172248879 missense probably benign 0.06
R3936:Mc3r UTSW 2 172249296 missense probably damaging 1.00
R4225:Mc3r UTSW 2 172249034 missense probably damaging 1.00
R5074:Mc3r UTSW 2 172249613 missense possibly damaging 0.95
R5277:Mc3r UTSW 2 172249787 missense probably damaging 1.00
R5706:Mc3r UTSW 2 172249690 nonsense probably null
R5832:Mc3r UTSW 2 172249430 missense probably benign 0.01
R5865:Mc3r UTSW 2 172249672 missense possibly damaging 0.84
R5881:Mc3r UTSW 2 172249172 missense probably benign 0.22
R5905:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R6028:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R6492:Mc3r UTSW 2 172249154 missense possibly damaging 0.84
R7037:Mc3r UTSW 2 172249634 missense probably damaging 1.00
Z1177:Mc3r UTSW 2 172249816 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAAACATCCTGGTGATCCTG -3'
(R):5'- GATGACCATCTTGCTCTCGG -3'

Sequencing Primer
(F):5'- GATCCTGGCTGTGGTCAG -3'
(R):5'- TGCTCTCGGAGTAGATGATGAACATC -3'
Posted On2015-07-21