Mutagenetix > Incidental Mutations

Incidental Mutation 'R4491:Plch1'

330710

Institutional Source

Beutler Lab

Gene Symbol

Plch1

Ensembl Gene

ENSMUSG00000036834

Gene Name

phospholipase C, eta 1

Synonyms

PLCeta1, Plcl3

MMRRC Submission

041747-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R4491 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63696234-63899472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63740739 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 404 (I404V)

Ref Sequence

ENSEMBL: ENSMUSP00000124463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048134
AA Change: I386V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: I386V

Domain	Start	End	E-Value	Type
PH	3	112	2.37e-6	SMART
EFh	128	156	2.41e-4	SMART
EFh	164	193	1.54e-2	SMART
Pfam:EF-hand_like	198	280	2.2e-26	PFAM
PLCXc	281	426	3.13e-71	SMART
low complexity region	440	453	N/A	INTRINSIC
low complexity region	564	581	N/A	INTRINSIC
PLCYc	583	696	3.4e-49	SMART
C2	715	823	5.47e-22	SMART
low complexity region	979	997	N/A	INTRINSIC
low complexity region	1079	1091	N/A	INTRINSIC
low complexity region	1420	1435	N/A	INTRINSIC
low complexity region	1543	1557	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000059973
AA Change: I404V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: I404V

Domain	Start	End	E-Value	Type
PH	21	130	1.1e-8	SMART
EFh	146	174	1.1e-6	SMART
EFh	182	211	7.6e-5	SMART
Pfam:EF-hand_like	216	298	4.5e-24	PFAM
PLCXc	299	444	1.6e-73	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	1.7e-51	SMART
C2	733	841	3.7e-24	SMART
low complexity region	1017	1035	N/A	INTRINSIC
low complexity region	1117	1129	N/A	INTRINSIC
low complexity region	1458	1473	N/A	INTRINSIC
low complexity region	1581	1595	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000084105
AA Change: I404V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: I404V

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	2.4e-27	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART
low complexity region	1018	1036	N/A	INTRINSIC
low complexity region	1118	1130	N/A	INTRINSIC
low complexity region	1459	1474	N/A	INTRINSIC
low complexity region	1582	1596	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159676
AA Change: I404V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834
AA Change: I404V

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.8e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159982

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160638
AA Change: I404V

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834
AA Change: I404V

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	5.3e-28	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162269
AA Change: I404V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834
AA Change: I404V

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.7e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175947
AA Change: I404V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834
AA Change: I404V

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.2e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	3.4e-49	SMART
C2	733	841	5.47e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000177143
AA Change: I416V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: I416V

Domain	Start	End	E-Value	Type
PH	33	142	2.37e-6	SMART
EFh	158	186	2.41e-4	SMART
EFh	194	223	1.54e-2	SMART
Pfam:EF-hand_like	228	310	2.3e-26	PFAM
PLCXc	311	456	3.13e-71	SMART
low complexity region	470	483	N/A	INTRINSIC
low complexity region	594	611	N/A	INTRINSIC
PLCYc	613	726	3.4e-49	SMART
C2	745	853	5.47e-22	SMART
low complexity region	1009	1027	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1450	1465	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Meta Mutation Damage Score

0.3882

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	A	5: 63,898,469	P183T	probably damaging	Het
6430573F11Rik	G	A	8: 36,505,606	C70Y	probably damaging	Het
Bcan	G	A	3: 87,990,233	R682*	probably null	Het
Bzw1	T	A	1: 58,404,259	L410Q	probably damaging	Het
Cdh5	A	T	8: 104,113,040	I48F	probably damaging	Het
Cdhr5	T	C	7: 141,274,057	N173D	possibly damaging	Het
Cfap74	T	C	4: 155,429,171	M480T	probably benign	Het
Col6a5	C	T	9: 105,940,012	A367T	unknown	Het
Colca2	A	G	9: 51,270,655	F206L	probably benign	Het
Cpsf1	A	C	15: 76,597,722	Y1064D	possibly damaging	Het
Defb6	A	T	8: 19,228,074	H54L	probably benign	Het
Dmtf1	A	G	5: 9,140,379		probably benign	Het
Dnah12	T	C	14: 26,734,603	L827S	possibly damaging	Het
Dsc3	T	C	18: 20,001,865	T21A	probably benign	Het
Epb41l1	G	T	2: 156,522,168	D866Y	probably benign	Het
Epha1	T	C	6: 42,360,666	M860V	probably damaging	Het
Far2	T	C	6: 148,173,409	L380P	possibly damaging	Het
Fgd5	A	G	6: 91,989,299	I680V	possibly damaging	Het
Fnbp4	T	C	2: 90,752,968		probably null	Het
Focad	G	A	4: 88,359,905		probably null	Het
Gm14180	T	A	11: 99,730,313		probably benign	Het
Hbb-bh2	T	C	7: 103,840,415	T5A	probably benign	Het
Ighv7-2	A	G	12: 113,912,480	F2L	probably benign	Het
Igsf5	A	G	16: 96,364,081	T19A	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Klb	A	G	5: 65,375,794	N482S	probably benign	Het
Lipo2	A	C	19: 33,721,700	L310R	probably damaging	Het
Mc3r	A	G	2: 172,249,203	H115R	possibly damaging	Het
Meioc	A	G	11: 102,674,920	D398G	possibly damaging	Het
Olfr1130	G	A	2: 87,607,392	M1I	probably null	Het
Olfr1353	T	C	10: 78,970,317	S223P	probably damaging	Het
Olfr683	A	T	7: 105,143,776	C172*	probably null	Het
Pds5a	T	C	5: 65,635,437	T718A	probably benign	Het
Pdzd2	C	T	15: 12,385,637	D1016N	possibly damaging	Het
Pla2g2c	T	C	4: 138,734,408		probably null	Het
Ppp2r5c	A	T	12: 110,580,522	D522V	possibly damaging	Het
Prex2	T	A	1: 11,162,263	S851R	probably benign	Het
Rapgef1	C	T	2: 29,719,656	P702S	possibly damaging	Het
Rasal3	T	A	17: 32,391,385	D976V	probably damaging	Het
Rasef	A	C	4: 73,734,503	L587R	probably damaging	Het
Rptn	A	T	3: 93,396,511	R384*	probably null	Het
Sema6a	G	A	18: 47,306,457		probably benign	Het
Sycp2	G	T	2: 178,374,985	T608K	probably damaging	Het
Syde1	C	T	10: 78,590,228	R35H	probably benign	Het
Taf1	G	T	X: 101,543,059	M313I	possibly damaging	Het
Taf15	A	T	11: 83,484,694	T31S	probably benign	Het
Tktl2	T	C	8: 66,512,012	V74A	probably damaging	Het
Tle4	A	G	19: 14,454,865	V489A	probably damaging	Het
Tmem30a	T	C	9: 79,777,285	H95R	probably damaging	Het
Vmn1r75	C	A	7: 11,880,982	Q214K	probably damaging	Het
Vps13c	C	T	9: 67,910,193	T1049M	probably benign	Het
Wdr78	T	C	4: 103,066,399	E411G	probably benign	Het
Zfp37	T	C	4: 62,192,128	Q274R	probably benign	Het
Zfp648	T	G	1: 154,205,127	L344R	probably damaging	Het

Other mutations in Plch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01397:Plch1	APN	3	63731729	splice site	probably null
IGL01542:Plch1	APN	3	63731649	missense	probably damaging	0.99
IGL01999:Plch1	APN	3	63753307	missense	probably damaging	1.00
IGL02153:Plch1	APN	3	63781351	missense	probably damaging	1.00
IGL02203:Plch1	APN	3	63698739	missense	possibly damaging	0.46
IGL02220:Plch1	APN	3	63698961	missense	probably damaging	0.97
IGL02259:Plch1	APN	3	63722749	critical splice donor site	probably null
IGL02268:Plch1	APN	3	63699283	makesense	probably null
IGL02411:Plch1	APN	3	63697756	splice site	probably null
IGL02472:Plch1	APN	3	63701849	missense	probably damaging	1.00
IGL02477:Plch1	APN	3	63753293	missense	probably damaging	1.00
IGL02503:Plch1	APN	3	63697864	missense	probably damaging	1.00
IGL02800:Plch1	APN	3	63698478	missense	probably benign	0.21
IGL03167:Plch1	APN	3	63722744	splice site	probably benign
IGL03182:Plch1	APN	3	63702594	nonsense	probably null
IGL03197:Plch1	APN	3	63753170	missense	probably damaging	1.00
IGL03251:Plch1	APN	3	63784002	missense	possibly damaging	0.93
BB009:Plch1	UTSW	3	63701981	missense	probably benign	0.05
BB019:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R0335:Plch1	UTSW	3	63710978	missense	probably damaging	1.00
R0347:Plch1	UTSW	3	63753316	missense	probably damaging	1.00
R0631:Plch1	UTSW	3	63699219	missense	probably benign	0.23
R0687:Plch1	UTSW	3	63716029	missense	probably damaging	1.00
R0738:Plch1	UTSW	3	63702553	intron	probably benign
R0883:Plch1	UTSW	3	63753256	missense	probably damaging	1.00
R1437:Plch1	UTSW	3	63697533	missense	probably benign	0.37
R1678:Plch1	UTSW	3	63740694	missense	probably damaging	1.00
R1738:Plch1	UTSW	3	63719238	missense	probably benign	0.12
R1929:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R1955:Plch1	UTSW	3	63755267	missense	probably damaging	0.98
R2078:Plch1	UTSW	3	63701943	missense	probably benign	0.01
R2112:Plch1	UTSW	3	63722806	missense	probably damaging	1.00
R2158:Plch1	UTSW	3	63721234	missense	probably benign	0.00
R2165:Plch1	UTSW	3	63698482	missense	probably benign	0.01
R2259:Plch1	UTSW	3	63697977	missense	possibly damaging	0.94
R2271:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R3110:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3112:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3407:Plch1	UTSW	3	63699347	unclassified	probably benign
R3408:Plch1	UTSW	3	63699347	unclassified	probably benign
R3791:Plch1	UTSW	3	63699523	missense	probably benign
R3793:Plch1	UTSW	3	63697831	missense	probably damaging	0.96
R3928:Plch1	UTSW	3	63767623	missense	probably damaging	1.00
R4211:Plch1	UTSW	3	63711219	missense	probably damaging	1.00
R4212:Plch1	UTSW	3	63870759	start gained	probably benign
R4223:Plch1	UTSW	3	63701900	missense	probably damaging	1.00
R4589:Plch1	UTSW	3	63781507	missense	probably damaging	1.00
R4656:Plch1	UTSW	3	63704177	missense	probably damaging	1.00
R4701:Plch1	UTSW	3	63699496	splice site	probably null
R4716:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R4772:Plch1	UTSW	3	63753325	missense	probably damaging	1.00
R4902:Plch1	UTSW	3	63740843	intron	probably benign
R5058:Plch1	UTSW	3	63722781	missense	probably damaging	1.00
R5092:Plch1	UTSW	3	63698710	missense	probably benign	0.02
R5093:Plch1	UTSW	3	63773715	missense	probably damaging	0.99
R5210:Plch1	UTSW	3	63699778	critical splice donor site	probably null
R5368:Plch1	UTSW	3	63701973	missense	possibly damaging	0.82
R5373:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5374:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5501:Plch1	UTSW	3	63707741	missense	probably damaging	1.00
R5606:Plch1	UTSW	3	63740687	missense	probably benign	0.35
R5738:Plch1	UTSW	3	63773655	missense	probably damaging	1.00
R5835:Plch1	UTSW	3	63697522	missense	probably benign
R6106:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6107:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6108:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6110:Plch1	UTSW	3	63698858	missense	possibly damaging	0.62
R6116:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6147:Plch1	UTSW	3	63722881	missense	probably damaging	1.00
R6195:Plch1	UTSW	3	63740789	missense	probably damaging	1.00
R6315:Plch1	UTSW	3	63781390	nonsense	probably null
R6316:Plch1	UTSW	3	63781390	nonsense	probably null
R6317:Plch1	UTSW	3	63781390	nonsense	probably null
R6318:Plch1	UTSW	3	63781390	nonsense	probably null
R6324:Plch1	UTSW	3	63781390	nonsense	probably null
R6325:Plch1	UTSW	3	63781390	nonsense	probably null
R6326:Plch1	UTSW	3	63781390	nonsense	probably null
R6479:Plch1	UTSW	3	63744510	missense	probably benign	0.06
R6544:Plch1	UTSW	3	63850978	missense	probably damaging	1.00
R6767:Plch1	UTSW	3	63755344	missense	probably damaging	1.00
R6829:Plch1	UTSW	3	63697518	missense	probably damaging	0.99
R6891:Plch1	UTSW	3	63698083	missense	probably benign
R6893:Plch1	UTSW	3	63753141	nonsense	probably null
R6921:Plch1	UTSW	3	63707734	missense	possibly damaging	0.90
R7298:Plch1	UTSW	3	63716037	nonsense	probably null
R7396:Plch1	UTSW	3	63698954	missense	probably benign	0.00
R7420:Plch1	UTSW	3	63722857	missense	probably damaging	1.00
R7566:Plch1	UTSW	3	63781242	splice site	probably null
R7572:Plch1	UTSW	3	63740684	missense	possibly damaging	0.89
R7649:Plch1	UTSW	3	63698169	nonsense	probably null
R7696:Plch1	UTSW	3	63755305	missense	probably benign
R7851:Plch1	UTSW	3	63698434	missense	probably damaging	0.99
R7853:Plch1	UTSW	3	63773647	missense	probably benign	0.44
R7932:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R7983:Plch1	UTSW	3	63707743	missense	probably damaging	1.00
R8057:Plch1	UTSW	3	63698136	missense	probably benign
R8066:Plch1	UTSW	3	63711057	nonsense	probably null
R8206:Plch1	UTSW	3	63702626	splice site	probably null
RF018:Plch1	UTSW	3	63721215	missense	probably damaging	1.00
X0028:Plch1	UTSW	3	63744509	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ACAGATACCCTTCACACGTATGG -3'
(R):5'- TCAGTTTCCCGGGAATTGAATG -3'

Sequencing Primer
(F):5'- TTTTTCGTCAACAAGGAGGAAG -3'
(R):5'- TTCCCGGGAATTGAATGATGCAATG -3'

Posted On

2015-07-21