Incidental Mutation 'R4491:Rptn'
ID330712
Institutional Source Beutler Lab
Gene Symbol Rptn
Ensembl Gene ENSMUSG00000041984
Gene Namerepetin
Synonyms
MMRRC Submission 041747-MU
Accession Numbers

Genbank: NM_009100; MGI: 1099055

Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4491 (G1)
Quality Score148
Status Validated
Chromosome3
Chromosomal Location93393699-93399442 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 93396511 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 384 (R384*)
Ref Sequence ENSEMBL: ENSMUSP00000044998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045912]
Predicted Effect probably null
Transcript: ENSMUST00000045912
AA Change: R384*
SMART Domains Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: R384*

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.2e-13 PFAM
Blast:EFh 53 81 5e-10 BLAST
low complexity region 189 204 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
Blast:CTD 318 461 1e-7 BLAST
low complexity region 1007 1041 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cdhr5 T C 7: 141,274,057 N173D possibly damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fgd5 A G 6: 91,989,299 I680V possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Mc3r A G 2: 172,249,203 H115R possibly damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Olfr683 A T 7: 105,143,776 C172* probably null Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Taf15 A T 11: 83,484,694 T31S probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Wdr78 T C 4: 103,066,399 E411G probably benign Het
Zfp37 T C 4: 62,192,128 Q274R probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Rptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Rptn APN 3 93397182 missense probably benign
IGL01070:Rptn APN 3 93398176 missense possibly damaging 0.86
IGL01625:Rptn APN 3 93397894 missense probably benign 0.18
IGL01678:Rptn APN 3 93396811 missense probably benign 0.00
IGL01716:Rptn APN 3 93396710 missense possibly damaging 0.53
IGL01767:Rptn APN 3 93395639 missense probably benign 0.00
IGL01872:Rptn APN 3 93396847 missense probably benign
IGL02000:Rptn APN 3 93396428 missense probably benign 0.01
IGL02066:Rptn APN 3 93397129 missense probably benign 0.01
IGL02090:Rptn APN 3 93396734 missense possibly damaging 0.85
IGL02116:Rptn APN 3 93395097 missense possibly damaging 0.88
IGL02216:Rptn APN 3 93395773 missense possibly damaging 0.73
IGL02368:Rptn APN 3 93397171 missense probably benign 0.18
IGL02820:Rptn APN 3 93396920 missense probably benign 0.01
IGL03323:Rptn APN 3 93397153 missense probably benign
IGL03404:Rptn APN 3 93398129 missense possibly damaging 0.53
D3080:Rptn UTSW 3 93395828 missense possibly damaging 0.85
H8786:Rptn UTSW 3 93397873 missense possibly damaging 0.53
IGL03097:Rptn UTSW 3 93397373 missense probably damaging 1.00
LCD18:Rptn UTSW 3 93397541 missense probably benign
PIT4431001:Rptn UTSW 3 93397397 small deletion probably benign
PIT4480001:Rptn UTSW 3 93397670 missense possibly damaging 0.85
R1024:Rptn UTSW 3 93398225 missense possibly damaging 0.72
R1119:Rptn UTSW 3 93396245 missense possibly damaging 0.96
R1727:Rptn UTSW 3 93397138 missense possibly damaging 0.73
R1901:Rptn UTSW 3 93396710 missense possibly damaging 0.53
R2247:Rptn UTSW 3 93396829 missense probably benign
R2921:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2922:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2923:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R3901:Rptn UTSW 3 93398357 missense probably benign
R3936:Rptn UTSW 3 93395576 missense possibly damaging 0.79
R4304:Rptn UTSW 3 93396931 missense probably benign 0.33
R4654:Rptn UTSW 3 93397485 missense possibly damaging 0.53
R4870:Rptn UTSW 3 93396469 nonsense probably null
R5246:Rptn UTSW 3 93396833 missense probably damaging 0.98
R5246:Rptn UTSW 3 93397729 missense possibly damaging 0.53
R5544:Rptn UTSW 3 93398473 missense possibly damaging 0.53
R5555:Rptn UTSW 3 93396701 missense probably benign
R5896:Rptn UTSW 3 93398332 nonsense probably null
R5956:Rptn UTSW 3 93398027 missense possibly damaging 0.53
R6192:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6209:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6224:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6226:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6227:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6230:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6247:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6258:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6393:Rptn UTSW 3 93397199 missense probably benign
R6513:Rptn UTSW 3 93396112 missense possibly damaging 0.73
R6854:Rptn UTSW 3 93398123 missense possibly damaging 0.53
R6855:Rptn UTSW 3 93398251 missense probably benign 0.33
R6884:Rptn UTSW 3 93395789 missense probably benign 0.33
R7018:Rptn UTSW 3 93397900 missense possibly damaging 0.73
R7241:Rptn UTSW 3 93395954 missense probably benign 0.01
R7337:Rptn UTSW 3 93396905 missense probably benign 0.03
R7754:Rptn UTSW 3 93395921 missense probably damaging 0.98
R7794:Rptn UTSW 3 93395729 missense probably benign
R7801:Rptn UTSW 3 93398224 missense possibly damaging 0.53
R8161:Rptn UTSW 3 93396693 small deletion probably benign
R8374:Rptn UTSW 3 93396295 nonsense probably null
R8671:Rptn UTSW 3 93398194 missense probably benign 0.18
R8804:Rptn UTSW 3 93395843 missense probably damaging 0.98
R8934:Rptn UTSW 3 93395912 missense probably benign 0.00
R8938:Rptn UTSW 3 93395025 missense possibly damaging 0.93
X0018:Rptn UTSW 3 93395941 nonsense probably null
Z1088:Rptn UTSW 3 93397427 missense probably benign 0.01
Z1176:Rptn UTSW 3 93395018 missense probably benign 0.26
Z1177:Rptn UTSW 3 93395643 nonsense probably null
Z1177:Rptn UTSW 3 93395712 missense probably benign 0.01
Z1177:Rptn UTSW 3 93397887 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAGTTTCCATTATGGCCAGAAAGG -3'
(R):5'- AGAACTCTGGTCTTGCCTGC -3'

Sequencing Primer
(F):5'- GCAGAAAAGACCAGAGTTTTCAAC -3'
(R):5'- GCCTTTCTGACCCTGGTGAG -3'
Posted On2015-07-21