Incidental Mutation 'R4491:Zfp37'
ID330714
Institutional Source Beutler Lab
Gene Symbol Zfp37
Ensembl Gene ENSMUSG00000028389
Gene Namezinc finger protein 37
SynonymsZfp-37, Tzn
MMRRC Submission 041747-MU
Accession Numbers

Genbank: NM_009554.3; Ensembl: ENSMUST00000068822

Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R4491 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62189540-62231047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62192128 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 274 (Q274R)
Ref Sequence ENSEMBL: ENSMUSP00000070463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068822] [ENSMUST00000129511] [ENSMUST00000220873] [ENSMUST00000221329] [ENSMUST00000222050] [ENSMUST00000222748]
Predicted Effect probably benign
Transcript: ENSMUST00000068822
AA Change: Q274R

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070463
Gene: ENSMUSG00000028389
AA Change: Q274R

DomainStartEndE-ValueType
KRAB 13 62 5.89e-12 SMART
low complexity region 113 122 N/A INTRINSIC
ZnF_C2H2 255 277 2.75e-3 SMART
ZnF_C2H2 283 305 3.95e-4 SMART
ZnF_C2H2 311 333 2.2e-2 SMART
ZnF_C2H2 339 361 8.02e-5 SMART
ZnF_C2H2 367 389 1.13e-4 SMART
ZnF_C2H2 395 417 9.88e-5 SMART
ZnF_C2H2 423 445 2.61e-4 SMART
ZnF_C2H2 451 473 6.08e-5 SMART
ZnF_C2H2 479 501 5.99e-4 SMART
ZnF_C2H2 507 529 5.99e-4 SMART
ZnF_C2H2 535 557 1.03e-2 SMART
ZnF_C2H2 563 585 9.88e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148664
Predicted Effect probably benign
Transcript: ENSMUST00000220873
AA Change: Q233R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000221329
AA Change: Q271R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000222050
AA Change: Q270R

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000222748
AA Change: Q233R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.1090 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to a large family of zinc finger proteins. A similar protein in mouse is thought to play a role in regulating the structures of the nucleolus and centromere in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cdhr5 T C 7: 141,274,057 N173D possibly damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fgd5 A G 6: 91,989,299 I680V possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Mc3r A G 2: 172,249,203 H115R possibly damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Olfr683 A T 7: 105,143,776 C172* probably null Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rptn A T 3: 93,396,511 R384* probably null Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Taf15 A T 11: 83,484,694 T31S probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Wdr78 T C 4: 103,066,399 E411G probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Zfp37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Zfp37 APN 4 62192311 missense possibly damaging 0.69
B6584:Zfp37 UTSW 4 62191378 missense probably damaging 1.00
R0383:Zfp37 UTSW 4 62191885 start codon destroyed probably null 0.61
R0457:Zfp37 UTSW 4 62191665 nonsense probably null
R1258:Zfp37 UTSW 4 62191817 missense probably damaging 1.00
R2072:Zfp37 UTSW 4 62191708 missense probably damaging 1.00
R2073:Zfp37 UTSW 4 62191708 missense probably damaging 1.00
R2261:Zfp37 UTSW 4 62191636 missense probably damaging 1.00
R2262:Zfp37 UTSW 4 62191636 missense probably damaging 1.00
R2507:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R2897:Zfp37 UTSW 4 62191777 missense probably damaging 1.00
R2898:Zfp37 UTSW 4 62191777 missense probably damaging 1.00
R3826:Zfp37 UTSW 4 62192563 missense probably benign 0.00
R3879:Zfp37 UTSW 4 62191335 nonsense probably null
R4034:Zfp37 UTSW 4 62191696 missense probably damaging 1.00
R4823:Zfp37 UTSW 4 62191503 missense probably benign 0.18
R5186:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R5650:Zfp37 UTSW 4 62191765 missense probably damaging 1.00
R5886:Zfp37 UTSW 4 62191234 missense probably damaging 1.00
R5925:Zfp37 UTSW 4 62191213 missense possibly damaging 0.47
R7050:Zfp37 UTSW 4 62191671 missense possibly damaging 0.72
R7553:Zfp37 UTSW 4 62191999 missense probably damaging 1.00
R7583:Zfp37 UTSW 4 62192016 start gained probably benign
R7646:Zfp37 UTSW 4 62191295 missense probably damaging 0.99
R8061:Zfp37 UTSW 4 62191428 nonsense probably null
X0026:Zfp37 UTSW 4 62205089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCACATTCATTACATTTGTAGGG -3'
(R):5'- ATGTGAGAAAGTATGCCGTCATAG -3'

Sequencing Primer
(F):5'- CCAGTATGGATTCTTAGATGGTCAG -3'
(R):5'- GAAAGTATGCCGTCATAGTGCATCC -3'
Posted On2015-07-21