Incidental Mutation 'R4491:Wdr78'
ID330717
Institutional Source Beutler Lab
Gene Symbol Wdr78
Ensembl Gene ENSMUSG00000035126
Gene NameWD repeat domain 78
Synonyms
MMRRC Submission 041747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4491 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location103038065-103114555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103066399 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 411 (E411G)
Ref Sequence ENSEMBL: ENSMUSP00000112018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036451] [ENSMUST00000036557] [ENSMUST00000106868] [ENSMUST00000116316]
Predicted Effect probably benign
Transcript: ENSMUST00000036451
AA Change: E411G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000037588
Gene: ENSMUSG00000035126
AA Change: E411G

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036557
AA Change: E88G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000042272
Gene: ENSMUSG00000035126
AA Change: E88G

DomainStartEndE-ValueType
low complexity region 59 67 N/A INTRINSIC
low complexity region 76 100 N/A INTRINSIC
WD40 133 172 9.24e-4 SMART
WD40 182 229 5.7e1 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 262 296 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106868
AA Change: E411G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102481
Gene: ENSMUSG00000035126
AA Change: E411G

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 8.61e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
low complexity region 601 613 N/A INTRINSIC
Blast:WD40 614 648 3e-12 BLAST
WD40 652 692 2.38e-6 SMART
WD40 695 734 1.48e-2 SMART
WD40 739 779 6.14e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116316
AA Change: E411G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112018
Gene: ENSMUSG00000035126
AA Change: E411G

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138960
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cdhr5 T C 7: 141,274,057 N173D possibly damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fgd5 A G 6: 91,989,299 I680V possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Mc3r A G 2: 172,249,203 H115R possibly damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Olfr683 A T 7: 105,143,776 C172* probably null Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rptn A T 3: 93,396,511 R384* probably null Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Taf15 A T 11: 83,484,694 T31S probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Zfp37 T C 4: 62,192,128 Q274R probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Wdr78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Wdr78 APN 4 103103242 missense possibly damaging 0.77
IGL01508:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01509:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01511:Wdr78 APN 4 103048361 missense possibly damaging 0.81
IGL01693:Wdr78 APN 4 103087330 splice site probably null
IGL01731:Wdr78 APN 4 103062435 missense probably benign 0.01
IGL02033:Wdr78 APN 4 103066293 missense possibly damaging 0.58
IGL02100:Wdr78 APN 4 103050149 missense probably damaging 1.00
IGL02218:Wdr78 APN 4 103096774 missense probably damaging 1.00
IGL02226:Wdr78 APN 4 103090398 missense probably benign 0.00
IGL02476:Wdr78 APN 4 103087348 missense possibly damaging 0.46
IGL02929:Wdr78 APN 4 103059991 nonsense probably null
R0070:Wdr78 UTSW 4 103059934 missense probably damaging 1.00
R0377:Wdr78 UTSW 4 103048259 missense probably damaging 1.00
R0433:Wdr78 UTSW 4 103103253 missense probably benign 0.41
R0518:Wdr78 UTSW 4 103064530 nonsense probably null
R0538:Wdr78 UTSW 4 103096618 missense possibly damaging 0.65
R0624:Wdr78 UTSW 4 103072857 splice site probably benign
R0894:Wdr78 UTSW 4 103049386 intron probably benign
R1463:Wdr78 UTSW 4 103087418 missense possibly damaging 0.95
R1818:Wdr78 UTSW 4 103072657 missense possibly damaging 0.67
R2073:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2075:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2436:Wdr78 UTSW 4 103066352 missense probably benign 0.01
R2851:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2852:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2853:Wdr78 UTSW 4 103050158 missense possibly damaging 0.90
R4792:Wdr78 UTSW 4 103072684 missense possibly damaging 0.94
R5223:Wdr78 UTSW 4 103049403 missense possibly damaging 0.87
R5290:Wdr78 UTSW 4 103049533 missense probably benign 0.00
R5465:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R5975:Wdr78 UTSW 4 103049589 missense probably benign 0.03
R6239:Wdr78 UTSW 4 103066443 missense probably benign
R6304:Wdr78 UTSW 4 103087356 missense probably benign 0.35
R6456:Wdr78 UTSW 4 103049549 missense probably benign 0.00
R6467:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R6813:Wdr78 UTSW 4 103048326 missense probably benign 0.26
R7161:Wdr78 UTSW 4 103096616 missense probably benign 0.28
R7198:Wdr78 UTSW 4 103062413 missense probably damaging 0.98
R7208:Wdr78 UTSW 4 103066352 missense probably benign 0.00
R7320:Wdr78 UTSW 4 103050187 missense possibly damaging 0.68
R7742:Wdr78 UTSW 4 103090433 missense probably benign
R8120:Wdr78 UTSW 4 103066334 missense probably damaging 1.00
Z1176:Wdr78 UTSW 4 103072771 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CGCTAGACTTGGGCTGTTACAG -3'
(R):5'- AAAGTTTCAGTAGGCTGGGG -3'

Sequencing Primer
(F):5'- CTGTTACAGCATTTGGTGACTTAC -3'
(R):5'- TATGTAATGCCACTAAGTGTCAGGG -3'
Posted On2015-07-21