Incidental Mutation 'R4491:Fgd5'
ID330725
Institutional Source Beutler Lab
Gene Symbol Fgd5
Ensembl Gene ENSMUSG00000034037
Gene NameFYVE, RhoGEF and PH domain containing 5
SynonymsC330025N11Rik, ZFYVE23
MMRRC Submission 041747-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock #R4491 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91978878-92076004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91989299 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 680 (I680V)
Ref Sequence ENSEMBL: ENSMUSP00000109093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089334] [ENSMUST00000113466]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089334
AA Change: I838V

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086748
Gene: ENSMUSG00000034037
AA Change: I838V

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
internal_repeat_1 126 169 2.6e-7 PROSPERO
internal_repeat_1 164 198 2.6e-7 PROSPERO
low complexity region 201 222 N/A INTRINSIC
low complexity region 254 269 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 426 442 N/A INTRINSIC
low complexity region 453 475 N/A INTRINSIC
low complexity region 652 663 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
low complexity region 727 736 N/A INTRINSIC
low complexity region 879 894 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Pfam:RhoGEF 946 1134 2.2e-28 PFAM
PH 1165 1260 4.93e-13 SMART
FYVE 1285 1353 2.51e-16 SMART
low complexity region 1368 1390 N/A INTRINSIC
PH 1416 1514 2.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113466
AA Change: I680V

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109093
Gene: ENSMUSG00000034037
AA Change: I680V

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
low complexity region 721 736 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
Pfam:RhoGEF 788 976 1.6e-27 PFAM
PH 1007 1102 4.93e-13 SMART
FYVE 1127 1195 2.51e-16 SMART
low complexity region 1210 1232 N/A INTRINSIC
PH 1258 1356 2.77e-7 SMART
Meta Mutation Damage Score 0.0879 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cdhr5 T C 7: 141,274,057 N173D possibly damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Mc3r A G 2: 172,249,203 H115R possibly damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Olfr683 A T 7: 105,143,776 C172* probably null Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rptn A T 3: 93,396,511 R384* probably null Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Taf15 A T 11: 83,484,694 T31S probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Wdr78 T C 4: 103,066,399 E411G probably benign Het
Zfp37 T C 4: 62,192,128 Q274R probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Fgd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Fgd5 APN 6 91988459 missense possibly damaging 0.63
IGL01354:Fgd5 APN 6 92061843 nonsense probably null
IGL01597:Fgd5 APN 6 91987929 missense probably damaging 1.00
IGL01648:Fgd5 APN 6 91989359 nonsense probably null
IGL01781:Fgd5 APN 6 91988717 missense possibly damaging 0.88
IGL01977:Fgd5 APN 6 92024562 missense probably benign 0.20
IGL02053:Fgd5 APN 6 92053244 missense probably benign 0.03
IGL02206:Fgd5 APN 6 91987258 utr 5 prime probably benign
IGL02825:Fgd5 APN 6 92038087 splice site probably null
IGL02838:Fgd5 APN 6 91987674 missense probably benign
IGL03126:Fgd5 APN 6 92065164 missense probably damaging 1.00
IGL03369:Fgd5 APN 6 91988415 missense probably damaging 1.00
hygeia UTSW 6 91989300 missense probably damaging 1.00
R0029:Fgd5 UTSW 6 92067558 missense probably benign 0.04
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0212:Fgd5 UTSW 6 91988208 missense probably damaging 1.00
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1159:Fgd5 UTSW 6 91988502 missense probably benign 0.00
R1199:Fgd5 UTSW 6 91986978 missense possibly damaging 0.87
R1493:Fgd5 UTSW 6 91987631 missense probably benign
R1602:Fgd5 UTSW 6 92066184 missense possibly damaging 0.95
R1953:Fgd5 UTSW 6 92024630 missense probably benign 0.31
R2280:Fgd5 UTSW 6 91988945 missense possibly damaging 0.86
R2437:Fgd5 UTSW 6 92062869 nonsense probably null
R2883:Fgd5 UTSW 6 91987109 unclassified probably null
R4133:Fgd5 UTSW 6 92069437 missense probably damaging 1.00
R4454:Fgd5 UTSW 6 91989186 missense probably damaging 1.00
R4606:Fgd5 UTSW 6 91988209 missense possibly damaging 0.67
R4981:Fgd5 UTSW 6 91989300 missense probably damaging 1.00
R5162:Fgd5 UTSW 6 92074234 missense probably damaging 1.00
R5525:Fgd5 UTSW 6 92066247 missense probably damaging 1.00
R5570:Fgd5 UTSW 6 91988687 missense probably damaging 1.00
R5936:Fgd5 UTSW 6 91987911 missense probably damaging 0.98
R6012:Fgd5 UTSW 6 91989341 missense possibly damaging 0.95
R6723:Fgd5 UTSW 6 91988030 missense probably benign
R6764:Fgd5 UTSW 6 91989421 missense probably damaging 0.96
R7187:Fgd5 UTSW 6 91988291 missense possibly damaging 0.54
R7383:Fgd5 UTSW 6 91987118 missense probably benign 0.01
R7418:Fgd5 UTSW 6 92024538 missense probably benign 0.11
R7788:Fgd5 UTSW 6 91988459 missense possibly damaging 0.63
R7882:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7895:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R7965:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7978:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R8041:Fgd5 UTSW 6 92061856 missense probably damaging 0.98
R8053:Fgd5 UTSW 6 91989444 missense probably benign 0.34
X0064:Fgd5 UTSW 6 92050040 missense probably benign 0.02
Z1176:Fgd5 UTSW 6 91988889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTCTACAGGGACAGCAAG -3'
(R):5'- ACAAAGGCCCACACTGTGAG -3'

Sequencing Primer
(F):5'- CAAGAGGAAAGGCGTCCCC -3'
(R):5'- CACTGTGAGAAAGGACCCGC -3'
Posted On2015-07-21