Incidental Mutation 'R4491:Taf15'
ID330743
Institutional Source Beutler Lab
Gene Symbol Taf15
Ensembl Gene ENSMUSG00000020680
Gene NameTATA-box binding protein associated factor 15
SynonymsTAFII68, 2610111C21Rik, Taf2n, 68kDa
MMRRC Submission 041747-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R4491 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83473086-83506743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83484694 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 31 (T31S)
Ref Sequence ENSEMBL: ENSMUSP00000021018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021018]
Predicted Effect probably benign
Transcript: ENSMUST00000021018
AA Change: T31S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021018
Gene: ENSMUSG00000020680
AA Change: T31S

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 44 70 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 103 128 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 173 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
RRM 233 314 1.34e-15 SMART
low complexity region 324 349 N/A INTRINSIC
ZnF_RBZ 354 380 1.62e-5 SMART
low complexity region 388 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126134
Predicted Effect probably benign
Transcript: ENSMUST00000133170
SMART Domains Protein: ENSMUSP00000119836
Gene: ENSMUSG00000020680

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
RRM 40 121 1.34e-15 SMART
low complexity region 131 156 N/A INTRINSIC
ZnF_RBZ 161 187 1.62e-5 SMART
low complexity region 195 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152405
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TET family of RNA-binding proteins. The encoded protein plays a role in RNA polymerase II gene transcription as a component of a distinct subset of multi-subunit transcription initiation factor TFIID complexes. Translocations involving this gene play a role in acute leukemia and extraskeletal myxoid chondrosarcoma, and mutations in this gene may play a role in amyotrophic lateral sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cdhr5 T C 7: 141,274,057 N173D possibly damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fgd5 A G 6: 91,989,299 I680V possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Mc3r A G 2: 172,249,203 H115R possibly damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Olfr683 A T 7: 105,143,776 C172* probably null Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rptn A T 3: 93,396,511 R384* probably null Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Wdr78 T C 4: 103,066,399 E411G probably benign Het
Zfp37 T C 4: 62,192,128 Q274R probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Taf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Taf15 APN 11 83488923 critical splice acceptor site probably null
IGL01151:Taf15 APN 11 83487371 missense possibly damaging 0.93
R0942:Taf15 UTSW 11 83499106 missense probably damaging 1.00
R1530:Taf15 UTSW 11 83487296 missense possibly damaging 0.86
R2267:Taf15 UTSW 11 83497262 missense probably damaging 0.98
R2437:Taf15 UTSW 11 83504753 intron probably benign
R3123:Taf15 UTSW 11 83504328 critical splice donor site probably null
R3155:Taf15 UTSW 11 83502773 missense probably benign 0.03
R3784:Taf15 UTSW 11 83506422 missense unknown
R4951:Taf15 UTSW 11 83484811 missense possibly damaging 0.64
R5104:Taf15 UTSW 11 83487396 missense probably damaging 1.00
R6814:Taf15 UTSW 11 83499089 missense probably damaging 1.00
R6987:Taf15 UTSW 11 83484695 missense possibly damaging 0.48
R7328:Taf15 UTSW 11 83484832 missense possibly damaging 0.96
R7431:Taf15 UTSW 11 83504953 missense unknown
R7624:Taf15 UTSW 11 83505023 missense unknown
X0028:Taf15 UTSW 11 83487396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAAGAGACAGGCAGAATTGTC -3'
(R):5'- CCACCATAGTTTTGTCCATACGAAG -3'

Sequencing Primer
(F):5'- GGCAGAATTGTCGTTTAAAAGTAAGC -3'
(R):5'- CGAAGAATCAGTCGTTTGCC -3'
Posted On2015-07-21