Incidental Mutation 'R4491:Pdzd2'
ID330749
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 041747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4491 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12385637 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1016 (D1016N)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075317
AA Change: D1016N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: D1016N

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cdhr5 T C 7: 141,274,057 N173D possibly damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fgd5 A G 6: 91,989,299 I680V possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Mc3r A G 2: 172,249,203 H115R possibly damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Olfr683 A T 7: 105,143,776 C172* probably null Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rptn A T 3: 93,396,511 R384* probably null Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Taf15 A T 11: 83,484,694 T31S probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Wdr78 T C 4: 103,066,399 E411G probably benign Het
Zfp37 T C 4: 62,192,128 Q274R probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 splice site probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12407372 missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12592163 missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12375909 missense probably benign
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGAACTTCTTGACCCTGAC -3'
(R):5'- TACACAAGCAAGTGACAGTCGC -3'

Sequencing Primer
(F):5'- TTCTTCTGGAGCCTCCGGG -3'
(R):5'- AGTGACAGTCGCTCGGCAAG -3'
Posted On2015-07-21