Mutagenetix > Incidental Mutations

Incidental Mutation 'R4491:Sema6a'

330754

Institutional Source

Beutler Lab

Gene Symbol

Sema6a

Ensembl Gene

ENSMUSG00000019647

Gene Name

sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A

Synonyms

sema, Sema6A-1, Semaq, A730020P05Rik, VIa

MMRRC Submission

041747-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4491 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47235598-47368870 bp(-) (GRCm38)

Type of Mutation

utr 5 prime

DNA Base Change (assembly)

G to A at 47306457 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019791] [ENSMUST00000076043] [ENSMUST00000115449] [ENSMUST00000126684] [ENSMUST00000135790] [ENSMUST00000156422]

Predicted Effect

probably benign
Transcript: ENSMUST00000019791

SMART Domains

Protein: ENSMUSP00000019791
Gene: ENSMUSG00000019647

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	648	670	N/A	INTRINSIC
low complexity region	932	951	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000076043

SMART Domains

Protein: ENSMUSP00000075420
Gene: ENSMUSG00000019647

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	593	615	N/A	INTRINSIC
low complexity region	877	896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115449

SMART Domains

Protein: ENSMUSP00000111109
Gene: ENSMUSG00000019647

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	461	1.24e-168	SMART
PSI	488	543	9.57e-1	SMART
transmembrane domain	622	644	N/A	INTRINSIC
low complexity region	906	925	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126684

SMART Domains

Protein: ENSMUSP00000118655
Gene: ENSMUSG00000019647

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Sema	56	216	2.5e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000135790

SMART Domains

Protein: ENSMUSP00000120011
Gene: ENSMUSG00000019647

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	949	968	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141224

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151382

Predicted Effect

probably benign
Transcript: ENSMUST00000156422

SMART Domains

Protein: ENSMUSP00000121442
Gene: ENSMUSG00000019647

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	648	670	N/A	INTRINSIC
low complexity region	932	951	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transmembrane semaphorin SEMA6A is expressed in developing neural tissue and is required for proper development of the thalamocortical projection (Leighton et al., 2001 [PubMed 11242070]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit defects in lamina-specific neurite stratification of specific retinal neuron subtypes and disruption of the dendritic plexus organization of On but not Off starburst amacrine cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	A	5: 63,898,469	P183T	probably damaging	Het
6430573F11Rik	G	A	8: 36,505,606	C70Y	probably damaging	Het
Bcan	G	A	3: 87,990,233	R682*	probably null	Het
Bzw1	T	A	1: 58,404,259	L410Q	probably damaging	Het
Cdh5	A	T	8: 104,113,040	I48F	probably damaging	Het
Cdhr5	T	C	7: 141,274,057	N173D	possibly damaging	Het
Cfap74	T	C	4: 155,429,171	M480T	probably benign	Het
Col6a5	C	T	9: 105,940,012	A367T	unknown	Het
Colca2	A	G	9: 51,270,655	F206L	probably benign	Het
Cpsf1	A	C	15: 76,597,722	Y1064D	possibly damaging	Het
Defb6	A	T	8: 19,228,074	H54L	probably benign	Het
Dmtf1	A	G	5: 9,140,379		probably benign	Het
Dnah12	T	C	14: 26,734,603	L827S	possibly damaging	Het
Dsc3	T	C	18: 20,001,865	T21A	probably benign	Het
Epb41l1	G	T	2: 156,522,168	D866Y	probably benign	Het
Epha1	T	C	6: 42,360,666	M860V	probably damaging	Het
Far2	T	C	6: 148,173,409	L380P	possibly damaging	Het
Fgd5	A	G	6: 91,989,299	I680V	possibly damaging	Het
Fnbp4	T	C	2: 90,752,968		probably null	Het
Focad	G	A	4: 88,359,905		probably null	Het
Gm14180	T	A	11: 99,730,313		probably benign	Het
Hbb-bh2	T	C	7: 103,840,415	T5A	probably benign	Het
Ighv7-2	A	G	12: 113,912,480	F2L	probably benign	Het
Igsf5	A	G	16: 96,364,081	T19A	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Klb	A	G	5: 65,375,794	N482S	probably benign	Het
Lipo2	A	C	19: 33,721,700	L310R	probably damaging	Het
Mc3r	A	G	2: 172,249,203	H115R	possibly damaging	Het
Meioc	A	G	11: 102,674,920	D398G	possibly damaging	Het
Olfr1130	G	A	2: 87,607,392	M1I	probably null	Het
Olfr1353	T	C	10: 78,970,317	S223P	probably damaging	Het
Olfr683	A	T	7: 105,143,776	C172*	probably null	Het
Pds5a	T	C	5: 65,635,437	T718A	probably benign	Het
Pdzd2	C	T	15: 12,385,637	D1016N	possibly damaging	Het
Pla2g2c	T	C	4: 138,734,408		probably null	Het
Plch1	T	C	3: 63,740,739	I404V	probably damaging	Het
Ppp2r5c	A	T	12: 110,580,522	D522V	possibly damaging	Het
Prex2	T	A	1: 11,162,263	S851R	probably benign	Het
Rapgef1	C	T	2: 29,719,656	P702S	possibly damaging	Het
Rasal3	T	A	17: 32,391,385	D976V	probably damaging	Het
Rasef	A	C	4: 73,734,503	L587R	probably damaging	Het
Rptn	A	T	3: 93,396,511	R384*	probably null	Het
Sycp2	G	T	2: 178,374,985	T608K	probably damaging	Het
Syde1	C	T	10: 78,590,228	R35H	probably benign	Het
Taf1	G	T	X: 101,543,059	M313I	possibly damaging	Het
Taf15	A	T	11: 83,484,694	T31S	probably benign	Het
Tktl2	T	C	8: 66,512,012	V74A	probably damaging	Het
Tle4	A	G	19: 14,454,865	V489A	probably damaging	Het
Tmem30a	T	C	9: 79,777,285	H95R	probably damaging	Het
Vmn1r75	C	A	7: 11,880,982	Q214K	probably damaging	Het
Vps13c	C	T	9: 67,910,193	T1049M	probably benign	Het
Wdr78	T	C	4: 103,066,399	E411G	probably benign	Het
Zfp37	T	C	4: 62,192,128	Q274R	probably benign	Het
Zfp648	T	G	1: 154,205,127	L344R	probably damaging	Het

Other mutations in Sema6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Sema6a	APN	18	47289975	critical splice donor site	probably null
IGL01351:Sema6a	APN	18	47281302	missense	possibly damaging	0.84
IGL01594:Sema6a	APN	18	47248817	missense	probably damaging	1.00
IGL01953:Sema6a	APN	18	47290120	nonsense	probably null
IGL02077:Sema6a	APN	18	47283398	missense	possibly damaging	0.94
IGL02632:Sema6a	APN	18	47290155	missense	probably damaging	1.00
IGL02957:Sema6a	APN	18	47249224	missense	probably damaging	1.00
IGL03013:Sema6a	APN	18	47248394	missense	probably benign	0.01
IGL03279:Sema6a	APN	18	47300090	nonsense	probably null
saphire	UTSW	18	47306429	nonsense	probably null
IGL02988:Sema6a	UTSW	18	47298214	missense	probably damaging	1.00
R0114:Sema6a	UTSW	18	47290177	missense	probably damaging	1.00
R0311:Sema6a	UTSW	18	47290045	splice site	probably null
R0312:Sema6a	UTSW	18	47290045	splice site	probably null
R0347:Sema6a	UTSW	18	47291129	missense	probably damaging	1.00
R0350:Sema6a	UTSW	18	47270718	missense	probably benign
R0366:Sema6a	UTSW	18	47290045	splice site	probably null
R0368:Sema6a	UTSW	18	47290045	splice site	probably null
R0391:Sema6a	UTSW	18	47290045	splice site	probably null
R0403:Sema6a	UTSW	18	47290045	splice site	probably null
R0466:Sema6a	UTSW	18	47290045	splice site	probably null
R0515:Sema6a	UTSW	18	47290045	splice site	probably null
R0517:Sema6a	UTSW	18	47290045	splice site	probably null
R0542:Sema6a	UTSW	18	47248576	missense	probably damaging	1.00
R0557:Sema6a	UTSW	18	47249500	missense	probably benign	0.01
R0569:Sema6a	UTSW	18	47270805	splice site	probably null
R0650:Sema6a	UTSW	18	47290045	splice site	probably null
R0689:Sema6a	UTSW	18	47290045	splice site	probably null
R0694:Sema6a	UTSW	18	47290045	splice site	probably null
R0726:Sema6a	UTSW	18	47291981	missense	probably damaging	1.00
R0741:Sema6a	UTSW	18	47290045	splice site	probably null
R0821:Sema6a	UTSW	18	47290045	splice site	probably null
R0824:Sema6a	UTSW	18	47290045	splice site	probably null
R0924:Sema6a	UTSW	18	47248492	missense	probably damaging	1.00
R1108:Sema6a	UTSW	18	47306431	missense	probably benign	0.02
R1255:Sema6a	UTSW	18	47249299	missense	probably damaging	0.98
R1422:Sema6a	UTSW	18	47306431	missense	probably benign	0.02
R1531:Sema6a	UTSW	18	47248999	missense	probably damaging	1.00
R1707:Sema6a	UTSW	18	47283445	missense	probably benign	0.04
R1746:Sema6a	UTSW	18	47306349	splice site	probably benign
R1807:Sema6a	UTSW	18	47276424	missense	possibly damaging	0.85
R1974:Sema6a	UTSW	18	47270629	missense	probably benign	0.04
R1987:Sema6a	UTSW	18	47300142	missense	probably damaging	1.00
R2044:Sema6a	UTSW	18	47306429	nonsense	probably null
R3719:Sema6a	UTSW	18	47249077	missense	probably damaging	1.00
R4552:Sema6a	UTSW	18	47291923	missense	probably damaging	1.00
R4707:Sema6a	UTSW	18	47248712	missense	probably benign	0.43
R4710:Sema6a	UTSW	18	47270683	missense	probably benign	0.00
R4713:Sema6a	UTSW	18	47249296	missense	possibly damaging	0.79
R4963:Sema6a	UTSW	18	47298251	missense	possibly damaging	0.48
R5088:Sema6a	UTSW	18	47249129	missense	probably damaging	1.00
R5133:Sema6a	UTSW	18	47300128	missense	probably damaging	1.00
R5135:Sema6a	UTSW	18	47291172	missense	probably damaging	1.00
R5141:Sema6a	UTSW	18	47248388	missense	probably damaging	1.00
R5277:Sema6a	UTSW	18	47276544	intron	probably benign
R5551:Sema6a	UTSW	18	47248528	missense	possibly damaging	0.76
R5618:Sema6a	UTSW	18	47281948	missense	probably damaging	0.98
R5717:Sema6a	UTSW	18	47249263	missense	probably benign	0.01
R5729:Sema6a	UTSW	18	47281343	missense	probably damaging	1.00
R5779:Sema6a	UTSW	18	47248826	missense	probably damaging	1.00
R5917:Sema6a	UTSW	18	47281338	missense	probably benign	0.05
R6054:Sema6a	UTSW	18	47283403	missense	possibly damaging	0.94
R6142:Sema6a	UTSW	18	47281199	missense	probably benign	0.00
R6209:Sema6a	UTSW	18	47298302	splice site	probably null
R6307:Sema6a	UTSW	18	47249164	missense	probably damaging	1.00
R6734:Sema6a	UTSW	18	47279169	missense	probably benign	0.31
R7014:Sema6a	UTSW	18	47298217	missense	probably damaging	1.00
R7033:Sema6a	UTSW	18	47248570	missense	probably damaging	0.96
R7574:Sema6a	UTSW	18	47291164	missense	probably damaging	1.00
R8054:Sema6a	UTSW	18	47291905	missense	probably damaging	1.00
R8250:Sema6a	UTSW	18	47290115	missense	probably damaging	0.99
R8408:Sema6a	UTSW	18	47248891	missense	probably benign	0.34
R8411:Sema6a	UTSW	18	47248955	missense	probably benign	0.00
X0065:Sema6a	UTSW	18	47283319	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- CCTTGTCACACATGCAGTTG -3'
(R):5'- ATTCACTGTGGACAAGGCAG -3'

Sequencing Primer
(F):5'- AAAATGACTGGGTCTCTCCG -3'
(R):5'- CAGGGAACAGAAGCCTTTTGTC -3'

Posted On

2015-07-21