Incidental Mutation 'R4492:Olfr231'
ID330762
Institutional Source Beutler Lab
Gene Symbol Olfr231
Ensembl Gene ENSMUSG00000046486
Gene Nameolfactory receptor 231
SynonymsOlfr244, GA_x6K02T2LER7-6-623, Olfr425, GA_x6K02T2P20D-21053942-21054499, GA_x6K02T02K39-452-3, MOR105-4
MMRRC Submission 041581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4492 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174113211-174121162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 174117204 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 271 (V271I)
Ref Sequence ENSEMBL: ENSMUSP00000151011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063030] [ENSMUST00000214446]
Predicted Effect probably benign
Transcript: ENSMUST00000063030
AA Change: V271I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000059596
Gene: ENSMUSG00000046486
AA Change: V271I

DomainStartEndE-ValueType
Pfam:7tm_4 24 300 2.6e-63 PFAM
Pfam:7tm_1 34 282 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214446
AA Change: V271I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T G 10: 89,725,814 I157L probably benign Het
Amph T C 13: 19,149,758 V663A possibly damaging Het
Anapc16 A G 10: 59,990,902 S50P possibly damaging Het
Ank3 T A 10: 69,808,925 V60D probably damaging Het
Btbd9 A G 17: 30,527,571 Y94H probably damaging Het
Chil3 A G 3: 106,155,701 I191T probably damaging Het
Clpb T C 7: 101,787,722 L668P probably damaging Het
Cyp2d22 G A 15: 82,374,370 H97Y probably benign Het
Dhrs7 A T 12: 72,653,125 N244K probably damaging Het
Dusp4 C T 8: 34,807,736 T3M possibly damaging Het
Edc4 GGATTTTAGCCA G 8: 105,885,068 probably null Het
Etl4 G A 2: 20,806,865 S1621N possibly damaging Het
Fam174a T C 1: 95,313,976 S54P probably benign Het
Fdxacb1 T C 9: 50,770,247 F7S probably damaging Het
Focad G A 4: 88,359,905 probably null Het
Gpr156 T A 16: 37,992,106 L268H probably damaging Het
Gpr17 A T 18: 31,947,251 I253N possibly damaging Het
H2-T23 A T 17: 36,032,166 N106K probably damaging Het
Hspa4 T C 11: 53,280,469 R303G probably damaging Het
Irgm1 G A 11: 48,866,128 silent Het
Jph1 A C 1: 16,997,546 I114S probably damaging Het
Kcna1 C T 6: 126,642,275 D361N possibly damaging Het
Kcna4 G A 2: 107,296,091 R390Q probably damaging Het
Lum C A 10: 97,568,438 P65H probably damaging Het
Mc4r A G 18: 66,859,640 L134P probably benign Het
Mroh8 A T 2: 157,258,040 I248N probably damaging Het
Nos2 A G 11: 78,950,095 T677A probably benign Het
Nup37 T A 10: 88,174,929 F257I possibly damaging Het
Olfr273 T C 4: 52,855,764 I250V probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pdzd2 A C 15: 12,419,481 M501R possibly damaging Het
Pitx1 T C 13: 55,828,652 K65E probably benign Het
Pla1a C T 16: 38,409,610 A247T probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Prss8 A G 7: 127,929,807 S26P probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rock2 T A 12: 16,977,683 C1334S probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Serpina6 A G 12: 103,646,887 W385R probably damaging Het
Slc12a5 T C 2: 164,979,343 M249T probably benign Het
Srsf9 T A 5: 115,332,592 I117N probably damaging Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc21a T C 9: 119,941,280 V139A probably benign Het
Zfp236 A T 18: 82,630,000 V1012D probably damaging Het
Zfp612 C A 8: 110,089,297 Q379K probably damaging Het
Zfp930 C T 8: 69,228,246 Q198* probably null Het
Other mutations in Olfr231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Olfr231 APN 1 174117533 missense probably damaging 1.00
IGL03126:Olfr231 APN 1 174117710 missense probably benign 0.07
R0200:Olfr231 UTSW 1 174117512 missense probably benign 0.00
R1292:Olfr231 UTSW 1 174117854 missense probably benign 0.16
R1966:Olfr231 UTSW 1 174117251 nonsense probably null
R2860:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R2861:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R2862:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R4594:Olfr231 UTSW 1 174117320 missense probably damaging 0.96
R4670:Olfr231 UTSW 1 174117861 missense probably benign 0.04
R4703:Olfr231 UTSW 1 174117398 missense possibly damaging 0.52
R6385:Olfr231 UTSW 1 174117296 missense probably damaging 1.00
R7085:Olfr231 UTSW 1 174117660 missense probably damaging 1.00
R7426:Olfr231 UTSW 1 174117187 missense probably benign 0.00
R7708:Olfr231 UTSW 1 174117734 missense probably damaging 0.99
R7780:Olfr231 UTSW 1 174117549 missense probably benign 0.02
Z1088:Olfr231 UTSW 1 174117315 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AACAAGTGGCCACCAGTGAC -3'
(R):5'- CATGGTAATTTTGGGGATGCCC -3'

Sequencing Primer
(F):5'- CAGTGACCTAGAGGAACATTTCATCG -3'
(R):5'- CCTCAGCAGAAGGGAGGCAC -3'
Posted On2015-07-21