Mutagenetix > Incidental Mutations

Incidental Mutation 'R4492:Slc12a5'

330766

Institutional Source

Beutler Lab

Gene Symbol

Slc12a5

Ensembl Gene

ENSMUSG00000017740

Gene Name

solute carrier family 12, member 5

Synonyms

KCC2

MMRRC Submission

041581-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4492 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

164960802-164999731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 164979343 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 249 (M249T)

Ref Sequence

ENSEMBL: ENSMUSP00000144623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]

Predicted Effect

probably benign
Transcript: ENSMUST00000099092
AA Change: M226T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: M226T

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	304	5.2e-22	PFAM
Pfam:AA_permease_2	364	632	1e-17	PFAM
Pfam:AA_permease	389	676	1.9e-42	PFAM
Pfam:SLC12	688	814	2.1e-19	PFAM
Pfam:SLC12	807	959	1.8e-20	PFAM
low complexity region	978	1002	N/A	INTRINSIC
Pfam:SLC12	1009	1115	2.1e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135918

Predicted Effect

probably benign
Transcript: ENSMUST00000202136

SMART Domains

Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	175	2.5e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202223
AA Change: M249T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: M249T

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	1e-19	PFAM
Pfam:AA_permease_2	386	655	4.5e-15	PFAM
Pfam:AA_permease	412	699	3.7e-40	PFAM
Pfam:SLC12	711	837	7.2e-17	PFAM
Pfam:SLC12	830	982	6.2e-18	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1030	1133	8.6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202479

SMART Domains

Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

Domain	Start	End	E-Value	Type
low complexity region	10	22	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:AA_permease	102	176	5.2e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202623
AA Change: M249T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: M249T

Domain	Start	End	E-Value	Type
low complexity region	11	19	N/A	INTRINSIC
low complexity region	100	113	N/A	INTRINSIC
Pfam:AA_permease	125	327	5.3e-22	PFAM
Pfam:AA_permease_2	386	655	1.2e-17	PFAM
Pfam:AA_permease	412	699	2e-42	PFAM
Pfam:SLC12	711	837	2.1e-19	PFAM
Pfam:SLC12	830	982	1.8e-20	PFAM
low complexity region	1001	1025	N/A	INTRINSIC
Pfam:SLC12	1032	1138	2.2e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208579

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr6	T	G	10: 89,725,814	I157L	probably benign	Het
Amph	T	C	13: 19,149,758	V663A	possibly damaging	Het
Anapc16	A	G	10: 59,990,902	S50P	possibly damaging	Het
Ank3	T	A	10: 69,808,925	V60D	probably damaging	Het
Btbd9	A	G	17: 30,527,571	Y94H	probably damaging	Het
Chil3	A	G	3: 106,155,701	I191T	probably damaging	Het
Clpb	T	C	7: 101,787,722	L668P	probably damaging	Het
Cyp2d22	G	A	15: 82,374,370	H97Y	probably benign	Het
Dhrs7	A	T	12: 72,653,125	N244K	probably damaging	Het
Dusp4	C	T	8: 34,807,736	T3M	possibly damaging	Het
Edc4	GGATTTTAGCCA	G	8: 105,885,068		probably null	Het
Etl4	G	A	2: 20,806,865	S1621N	possibly damaging	Het
Fam174a	T	C	1: 95,313,976	S54P	probably benign	Het
Fdxacb1	T	C	9: 50,770,247	F7S	probably damaging	Het
Focad	G	A	4: 88,359,905		probably null	Het
Gpr156	T	A	16: 37,992,106	L268H	probably damaging	Het
Gpr17	A	T	18: 31,947,251	I253N	possibly damaging	Het
H2-T23	A	T	17: 36,032,166	N106K	probably damaging	Het
Hspa4	T	C	11: 53,280,469	R303G	probably damaging	Het
Irgm1	G	A	11: 48,866,128		silent	Het
Jph1	A	C	1: 16,997,546	I114S	probably damaging	Het
Kcna1	C	T	6: 126,642,275	D361N	possibly damaging	Het
Kcna4	G	A	2: 107,296,091	R390Q	probably damaging	Het
Lum	C	A	10: 97,568,438	P65H	probably damaging	Het
Mc4r	A	G	18: 66,859,640	L134P	probably benign	Het
Mroh8	A	T	2: 157,258,040	I248N	probably damaging	Het
Nos2	A	G	11: 78,950,095	T677A	probably benign	Het
Nup37	T	A	10: 88,174,929	F257I	possibly damaging	Het
Olfr231	C	T	1: 174,117,204	V271I	probably benign	Het
Olfr273	T	C	4: 52,855,764	I250V	probably benign	Het
Pdzd2	C	T	15: 12,385,637	D1016N	possibly damaging	Het
Pdzd2	A	C	15: 12,419,481	M501R	possibly damaging	Het
Pitx1	T	C	13: 55,828,652	K65E	probably benign	Het
Pla1a	C	T	16: 38,409,610	A247T	probably benign	Het
Prex2	T	A	1: 11,162,263	S851R	probably benign	Het
Prss8	A	G	7: 127,929,807	S26P	probably damaging	Het
Rasef	A	C	4: 73,734,503	L587R	probably damaging	Het
Rock2	T	A	12: 16,977,683	C1334S	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,923		probably benign	Het
Serpina6	A	G	12: 103,646,887	W385R	probably damaging	Het
Srsf9	T	A	5: 115,332,592	I117N	probably damaging	Het
Taf1	G	T	X: 101,543,059	M313I	possibly damaging	Het
Tmem30a	T	C	9: 79,777,285	H95R	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc21a	T	C	9: 119,941,280	V139A	probably benign	Het
Zfp236	A	T	18: 82,630,000	V1012D	probably damaging	Het
Zfp612	C	A	8: 110,089,297	Q379K	probably damaging	Het
Zfp930	C	T	8: 69,228,246	Q198*	probably null	Het

Other mutations in Slc12a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Slc12a5	APN	2	164997121	missense	probably damaging	1.00
IGL00425:Slc12a5	APN	2	164983281	missense	probably damaging	1.00
IGL00976:Slc12a5	APN	2	164979304	missense	probably damaging	1.00
IGL01654:Slc12a5	APN	2	164973755	missense	possibly damaging	0.91
IGL01905:Slc12a5	APN	2	164990381	missense	probably benign	0.02
IGL02205:Slc12a5	APN	2	164996479	missense	probably benign	0.03
IGL02510:Slc12a5	APN	2	164982808	splice site	probably benign
IGL02746:Slc12a5	APN	2	164974916	missense	probably benign	0.01
R0051:Slc12a5	UTSW	2	164986663	missense	probably damaging	1.00
R0254:Slc12a5	UTSW	2	164997245	critical splice donor site	probably null
R0412:Slc12a5	UTSW	2	164994062	missense	probably benign	0.05
R0587:Slc12a5	UTSW	2	164976533	missense	probably damaging	1.00
R0835:Slc12a5	UTSW	2	164994038	missense	probably damaging	0.97
R0932:Slc12a5	UTSW	2	164996885	splice site	probably benign
R1643:Slc12a5	UTSW	2	164994027	missense	probably benign	0.01
R1700:Slc12a5	UTSW	2	164992376	missense	possibly damaging	0.94
R1760:Slc12a5	UTSW	2	164996128	missense	probably damaging	0.99
R2063:Slc12a5	UTSW	2	164997147	missense	probably damaging	1.00
R2293:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R2412:Slc12a5	UTSW	2	164976462	critical splice donor site	probably null
R3035:Slc12a5	UTSW	2	164980258	missense	probably benign	0.06
R3116:Slc12a5	UTSW	2	164996181	splice site	probably null
R3412:Slc12a5	UTSW	2	164968431	missense	probably benign	0.26
R3788:Slc12a5	UTSW	2	164993775	missense	probably damaging	1.00
R4039:Slc12a5	UTSW	2	164992330	missense	probably benign	0.03
R4174:Slc12a5	UTSW	2	164979490	missense	probably damaging	1.00
R4608:Slc12a5	UTSW	2	164973765	missense	probably damaging	0.99
R4750:Slc12a5	UTSW	2	164982931	missense	probably benign	0.06
R4994:Slc12a5	UTSW	2	164983365	splice site	probably null
R5103:Slc12a5	UTSW	2	164992433	missense	probably damaging	1.00
R5539:Slc12a5	UTSW	2	164987206	missense	possibly damaging	0.94
R5632:Slc12a5	UTSW	2	164987221	missense	possibly damaging	0.86
R5771:Slc12a5	UTSW	2	164973768	missense	possibly damaging	0.88
R6139:Slc12a5	UTSW	2	164992311	missense	probably damaging	0.98
R6336:Slc12a5	UTSW	2	164992464	splice site	probably null
R6581:Slc12a5	UTSW	2	164987115	missense	probably damaging	1.00
R6706:Slc12a5	UTSW	2	164988589	missense	probably damaging	1.00
R6886:Slc12a5	UTSW	2	164982905	missense	probably benign
R7134:Slc12a5	UTSW	2	164974958	missense	probably damaging	1.00
R7310:Slc12a5	UTSW	2	164992440	missense	probably damaging	1.00
R7402:Slc12a5	UTSW	2	164982932	missense	probably benign	0.01
R8079:Slc12a5	UTSW	2	164992452	missense	probably damaging	1.00
R8301:Slc12a5	UTSW	2	164993691	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCATAGACATTGTGAGAGAGCC -3'
(R):5'- GACAGCACTCACGGGAAATTG -3'

Sequencing Primer
(F):5'- GAGAGAGCCCACTGCATCTTTTAG -3'
(R):5'- CACTCACGGGAAATTGGGTGG -3'

Posted On

2015-07-21