Incidental Mutation 'R4492:Slc12a5'
ID 330766
Institutional Source Beutler Lab
Gene Symbol Slc12a5
Ensembl Gene ENSMUSG00000017740
Gene Name solute carrier family 12, member 5
Synonyms KCC2
MMRRC Submission 041581-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4492 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 164802766-164841651 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 164821263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 249 (M249T)
Ref Sequence ENSEMBL: ENSMUSP00000144623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]
AlphaFold Q91V14
Predicted Effect probably benign
Transcript: ENSMUST00000099092
AA Change: M226T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: M226T

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 304 5.2e-22 PFAM
Pfam:AA_permease_2 364 632 1e-17 PFAM
Pfam:AA_permease 389 676 1.9e-42 PFAM
Pfam:SLC12 688 814 2.1e-19 PFAM
Pfam:SLC12 807 959 1.8e-20 PFAM
low complexity region 978 1002 N/A INTRINSIC
Pfam:SLC12 1009 1115 2.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135918
Predicted Effect probably benign
Transcript: ENSMUST00000202136
SMART Domains Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 175 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202223
AA Change: M249T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: M249T

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 1e-19 PFAM
Pfam:AA_permease_2 386 655 4.5e-15 PFAM
Pfam:AA_permease 412 699 3.7e-40 PFAM
Pfam:SLC12 711 837 7.2e-17 PFAM
Pfam:SLC12 830 982 6.2e-18 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1030 1133 8.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202479
SMART Domains Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 176 5.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202623
AA Change: M249T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: M249T

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 5.3e-22 PFAM
Pfam:AA_permease_2 386 655 1.2e-17 PFAM
Pfam:AA_permease 412 699 2e-42 PFAM
Pfam:SLC12 711 837 2.1e-19 PFAM
Pfam:SLC12 830 982 1.8e-20 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1032 1138 2.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208579
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T G 10: 89,561,676 (GRCm39) I157L probably benign Het
Amph T C 13: 19,333,928 (GRCm39) V663A possibly damaging Het
Anapc16 A G 10: 59,826,724 (GRCm39) S50P possibly damaging Het
Ank3 T A 10: 69,644,755 (GRCm39) V60D probably damaging Het
Btbd9 A G 17: 30,746,545 (GRCm39) Y94H probably damaging Het
Chil3 A G 3: 106,063,017 (GRCm39) I191T probably damaging Het
Clpb T C 7: 101,436,929 (GRCm39) L668P probably damaging Het
Cyp2d22 G A 15: 82,258,571 (GRCm39) H97Y probably benign Het
Dhrs7 A T 12: 72,699,899 (GRCm39) N244K probably damaging Het
Dusp4 C T 8: 35,274,890 (GRCm39) T3M possibly damaging Het
Edc4 GGATTTTAGCCA G 8: 106,611,700 (GRCm39) probably null Het
Etl4 G A 2: 20,811,676 (GRCm39) S1621N possibly damaging Het
Fam174a T C 1: 95,241,701 (GRCm39) S54P probably benign Het
Fdxacb1 T C 9: 50,681,547 (GRCm39) F7S probably damaging Het
Focad G A 4: 88,278,142 (GRCm39) probably null Het
Gpr156 T A 16: 37,812,468 (GRCm39) L268H probably damaging Het
Gpr17 A T 18: 32,080,304 (GRCm39) I253N possibly damaging Het
H2-T23 A T 17: 36,343,058 (GRCm39) N106K probably damaging Het
Hspa4 T C 11: 53,171,296 (GRCm39) R303G probably damaging Het
Irgm1 G A 11: 48,756,955 (GRCm39) silent Het
Jph1 A C 1: 17,067,770 (GRCm39) I114S probably damaging Het
Kcna1 C T 6: 126,619,238 (GRCm39) D361N possibly damaging Het
Kcna4 G A 2: 107,126,436 (GRCm39) R390Q probably damaging Het
Lum C A 10: 97,404,300 (GRCm39) P65H probably damaging Het
Mc4r A G 18: 66,992,711 (GRCm39) L134P probably benign Het
Mroh8 A T 2: 157,099,960 (GRCm39) I248N probably damaging Het
Nos2 A G 11: 78,840,921 (GRCm39) T677A probably benign Het
Nup37 T A 10: 88,010,791 (GRCm39) F257I possibly damaging Het
Or13c3 T C 4: 52,855,764 (GRCm39) I250V probably benign Het
Or6k6 C T 1: 173,944,770 (GRCm39) V271I probably benign Het
Pdzd2 C T 15: 12,385,723 (GRCm39) D1016N possibly damaging Het
Pdzd2 A C 15: 12,419,567 (GRCm39) M501R possibly damaging Het
Pitx1 T C 13: 55,976,465 (GRCm39) K65E probably benign Het
Pla1a C T 16: 38,229,972 (GRCm39) A247T probably benign Het
Prex2 T A 1: 11,232,487 (GRCm39) S851R probably benign Het
Prss8 A G 7: 127,528,979 (GRCm39) S26P probably damaging Het
Rasef A C 4: 73,652,740 (GRCm39) L587R probably damaging Het
Rock2 T A 12: 17,027,684 (GRCm39) C1334S probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,130 (GRCm39) probably benign Het
Serpina6 A G 12: 103,613,146 (GRCm39) W385R probably damaging Het
Srsf9 T A 5: 115,470,651 (GRCm39) I117N probably damaging Het
Taf1 G T X: 100,586,665 (GRCm39) M313I possibly damaging Het
Tmem30a T C 9: 79,684,567 (GRCm39) H95R probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttc21a T C 9: 119,770,346 (GRCm39) V139A probably benign Het
Zfp236 A T 18: 82,648,125 (GRCm39) V1012D probably damaging Het
Zfp612 C A 8: 110,815,929 (GRCm39) Q379K probably damaging Het
Zfp930 C T 8: 69,680,898 (GRCm39) Q198* probably null Het
Other mutations in Slc12a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Slc12a5 APN 2 164,839,041 (GRCm39) missense probably damaging 1.00
IGL00425:Slc12a5 APN 2 164,825,201 (GRCm39) missense probably damaging 1.00
IGL00976:Slc12a5 APN 2 164,821,224 (GRCm39) missense probably damaging 1.00
IGL01654:Slc12a5 APN 2 164,815,675 (GRCm39) missense possibly damaging 0.91
IGL01905:Slc12a5 APN 2 164,832,301 (GRCm39) missense probably benign 0.02
IGL02205:Slc12a5 APN 2 164,838,399 (GRCm39) missense probably benign 0.03
IGL02510:Slc12a5 APN 2 164,824,728 (GRCm39) splice site probably benign
IGL02746:Slc12a5 APN 2 164,816,836 (GRCm39) missense probably benign 0.01
G1Funyon:Slc12a5 UTSW 2 164,835,611 (GRCm39) missense probably damaging 0.98
R0051:Slc12a5 UTSW 2 164,828,583 (GRCm39) missense probably damaging 1.00
R0254:Slc12a5 UTSW 2 164,839,165 (GRCm39) critical splice donor site probably null
R0412:Slc12a5 UTSW 2 164,835,982 (GRCm39) missense probably benign 0.05
R0587:Slc12a5 UTSW 2 164,818,453 (GRCm39) missense probably damaging 1.00
R0835:Slc12a5 UTSW 2 164,835,958 (GRCm39) missense probably damaging 0.97
R0932:Slc12a5 UTSW 2 164,838,805 (GRCm39) splice site probably benign
R1643:Slc12a5 UTSW 2 164,835,947 (GRCm39) missense probably benign 0.01
R1700:Slc12a5 UTSW 2 164,834,296 (GRCm39) missense possibly damaging 0.94
R1760:Slc12a5 UTSW 2 164,838,048 (GRCm39) missense probably damaging 0.99
R2063:Slc12a5 UTSW 2 164,839,067 (GRCm39) missense probably damaging 1.00
R2293:Slc12a5 UTSW 2 164,834,250 (GRCm39) missense probably benign 0.03
R2412:Slc12a5 UTSW 2 164,818,382 (GRCm39) critical splice donor site probably null
R3035:Slc12a5 UTSW 2 164,822,178 (GRCm39) missense probably benign 0.06
R3116:Slc12a5 UTSW 2 164,838,101 (GRCm39) splice site probably null
R3412:Slc12a5 UTSW 2 164,810,351 (GRCm39) missense probably benign 0.26
R3788:Slc12a5 UTSW 2 164,835,695 (GRCm39) missense probably damaging 1.00
R4039:Slc12a5 UTSW 2 164,834,250 (GRCm39) missense probably benign 0.03
R4174:Slc12a5 UTSW 2 164,821,410 (GRCm39) missense probably damaging 1.00
R4608:Slc12a5 UTSW 2 164,815,685 (GRCm39) missense probably damaging 0.99
R4750:Slc12a5 UTSW 2 164,824,851 (GRCm39) missense probably benign 0.06
R4994:Slc12a5 UTSW 2 164,825,285 (GRCm39) splice site probably null
R5103:Slc12a5 UTSW 2 164,834,353 (GRCm39) missense probably damaging 1.00
R5539:Slc12a5 UTSW 2 164,829,126 (GRCm39) missense possibly damaging 0.94
R5632:Slc12a5 UTSW 2 164,829,141 (GRCm39) missense possibly damaging 0.86
R5771:Slc12a5 UTSW 2 164,815,688 (GRCm39) missense possibly damaging 0.88
R6139:Slc12a5 UTSW 2 164,834,231 (GRCm39) missense probably damaging 0.98
R6336:Slc12a5 UTSW 2 164,834,384 (GRCm39) splice site probably null
R6581:Slc12a5 UTSW 2 164,829,035 (GRCm39) missense probably damaging 1.00
R6706:Slc12a5 UTSW 2 164,830,509 (GRCm39) missense probably damaging 1.00
R6886:Slc12a5 UTSW 2 164,824,825 (GRCm39) missense probably benign
R7134:Slc12a5 UTSW 2 164,816,878 (GRCm39) missense probably damaging 1.00
R7310:Slc12a5 UTSW 2 164,834,360 (GRCm39) missense probably damaging 1.00
R7402:Slc12a5 UTSW 2 164,824,852 (GRCm39) missense probably benign 0.01
R8079:Slc12a5 UTSW 2 164,834,372 (GRCm39) missense probably damaging 1.00
R8301:Slc12a5 UTSW 2 164,835,611 (GRCm39) missense probably damaging 0.98
R9105:Slc12a5 UTSW 2 164,838,114 (GRCm39) missense probably benign
R9132:Slc12a5 UTSW 2 164,835,876 (GRCm39) intron probably benign
R9431:Slc12a5 UTSW 2 164,832,178 (GRCm39) missense possibly damaging 0.95
R9580:Slc12a5 UTSW 2 164,816,896 (GRCm39) missense probably damaging 0.99
R9677:Slc12a5 UTSW 2 164,834,246 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCATAGACATTGTGAGAGAGCC -3'
(R):5'- GACAGCACTCACGGGAAATTG -3'

Sequencing Primer
(F):5'- GAGAGAGCCCACTGCATCTTTTAG -3'
(R):5'- CACTCACGGGAAATTGGGTGG -3'
Posted On 2015-07-21