Incidental Mutation 'R4492:Chil3'
ID 330768
Institutional Source Beutler Lab
Gene Symbol Chil3
Ensembl Gene ENSMUSG00000040809
Gene Name chitinase-like 3
Synonyms Ym1, Chi3l3
MMRRC Submission 041581-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock # R4492 (G1)
Quality Score 138
Status Not validated
Chromosome 3
Chromosomal Location 106147554-106167564 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106155701 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 191 (I191T)
Ref Sequence ENSEMBL: ENSMUSP00000053923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063062]
AlphaFold O35744
PDB Structure THE CRYSTAL STRUCTURE OF NOVEL MAMMALIAN LECTIN YM1 SUGGESTS A SACCHARIDE BINDING SITE [X-RAY DIFFRACTION]
The Crystal Structure of Ym1 at 1.31 A Resolution [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000063062
AA Change: I191T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053923
Gene: ENSMUSG00000040809
AA Change: I191T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 5.17e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129563
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to bacterial chitinases but lacks chitinase activity. The encoded protein is thought to function as a lectin and may be involved in inflammation and allergy. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T G 10: 89,725,814 I157L probably benign Het
Amph T C 13: 19,149,758 V663A possibly damaging Het
Anapc16 A G 10: 59,990,902 S50P possibly damaging Het
Ank3 T A 10: 69,808,925 V60D probably damaging Het
Btbd9 A G 17: 30,527,571 Y94H probably damaging Het
Clpb T C 7: 101,787,722 L668P probably damaging Het
Cyp2d22 G A 15: 82,374,370 H97Y probably benign Het
Dhrs7 A T 12: 72,653,125 N244K probably damaging Het
Dusp4 C T 8: 34,807,736 T3M possibly damaging Het
Edc4 GGATTTTAGCCA G 8: 105,885,068 probably null Het
Etl4 G A 2: 20,806,865 S1621N possibly damaging Het
Fam174a T C 1: 95,313,976 S54P probably benign Het
Fdxacb1 T C 9: 50,770,247 F7S probably damaging Het
Focad G A 4: 88,359,905 probably null Het
Gpr156 T A 16: 37,992,106 L268H probably damaging Het
Gpr17 A T 18: 31,947,251 I253N possibly damaging Het
H2-T23 A T 17: 36,032,166 N106K probably damaging Het
Hspa4 T C 11: 53,280,469 R303G probably damaging Het
Irgm1 G A 11: 48,866,128 silent Het
Jph1 A C 1: 16,997,546 I114S probably damaging Het
Kcna1 C T 6: 126,642,275 D361N possibly damaging Het
Kcna4 G A 2: 107,296,091 R390Q probably damaging Het
Lum C A 10: 97,568,438 P65H probably damaging Het
Mc4r A G 18: 66,859,640 L134P probably benign Het
Mroh8 A T 2: 157,258,040 I248N probably damaging Het
Nos2 A G 11: 78,950,095 T677A probably benign Het
Nup37 T A 10: 88,174,929 F257I possibly damaging Het
Olfr231 C T 1: 174,117,204 V271I probably benign Het
Olfr273 T C 4: 52,855,764 I250V probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pdzd2 A C 15: 12,419,481 M501R possibly damaging Het
Pitx1 T C 13: 55,828,652 K65E probably benign Het
Pla1a C T 16: 38,409,610 A247T probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Prss8 A G 7: 127,929,807 S26P probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rock2 T A 12: 16,977,683 C1334S probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Serpina6 A G 12: 103,646,887 W385R probably damaging Het
Slc12a5 T C 2: 164,979,343 M249T probably benign Het
Srsf9 T A 5: 115,332,592 I117N probably damaging Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc21a T C 9: 119,941,280 V139A probably benign Het
Zfp236 A T 18: 82,630,000 V1012D probably damaging Het
Zfp612 C A 8: 110,089,297 Q379K probably damaging Het
Zfp930 C T 8: 69,228,246 Q198* probably null Het
Other mutations in Chil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Chil3 APN 3 106148701 missense probably damaging 1.00
IGL01552:Chil3 APN 3 106148848 missense probably damaging 0.98
IGL02538:Chil3 APN 3 106164129 missense probably damaging 1.00
PIT4382001:Chil3 UTSW 3 106148659 missense probably damaging 1.00
R0145:Chil3 UTSW 3 106160478 missense probably damaging 1.00
R0269:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0310:Chil3 UTSW 3 106160523 missense possibly damaging 0.75
R0453:Chil3 UTSW 3 106148905 missense probably benign 0.26
R0541:Chil3 UTSW 3 106161232 critical splice acceptor site probably null
R0617:Chil3 UTSW 3 106155756 missense probably benign 0.00
R0831:Chil3 UTSW 3 106149747 missense probably benign 0.19
R1699:Chil3 UTSW 3 106160366 critical splice donor site probably null
R1851:Chil3 UTSW 3 106148801 critical splice donor site probably null
R1852:Chil3 UTSW 3 106148801 critical splice donor site probably null
R2105:Chil3 UTSW 3 106160478 missense possibly damaging 0.73
R2202:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2204:Chil3 UTSW 3 106164246 missense probably benign 0.11
R2205:Chil3 UTSW 3 106164246 missense probably benign 0.11
R4358:Chil3 UTSW 3 106160499 nonsense probably null
R4543:Chil3 UTSW 3 106160370 missense probably benign
R4554:Chil3 UTSW 3 106160370 missense probably benign
R4930:Chil3 UTSW 3 106164208 missense possibly damaging 0.67
R5011:Chil3 UTSW 3 106150161 missense possibly damaging 0.46
R5083:Chil3 UTSW 3 106164089 critical splice donor site probably null
R5231:Chil3 UTSW 3 106155729 missense probably damaging 0.96
R5423:Chil3 UTSW 3 106148662 missense probably damaging 1.00
R6804:Chil3 UTSW 3 106164179 nonsense probably null
R6859:Chil3 UTSW 3 106160414 missense probably benign 0.14
R7218:Chil3 UTSW 3 106160537 splice site probably null
R7391:Chil3 UTSW 3 106164180 missense probably damaging 1.00
R7426:Chil3 UTSW 3 106155706 missense probably benign 0.05
R7582:Chil3 UTSW 3 106164256 missense probably damaging 1.00
R7620:Chil3 UTSW 3 106160435 missense probably damaging 1.00
R7647:Chil3 UTSW 3 106148806 missense possibly damaging 0.73
R7749:Chil3 UTSW 3 106148845 missense probably benign 0.22
R7944:Chil3 UTSW 3 106150148 nonsense probably null
R8099:Chil3 UTSW 3 106148668 missense probably damaging 1.00
R8181:Chil3 UTSW 3 106149887 missense probably damaging 0.98
R8859:Chil3 UTSW 3 106164124 missense possibly damaging 0.86
R9011:Chil3 UTSW 3 106149715 nonsense probably null
R9193:Chil3 UTSW 3 106155765 missense possibly damaging 0.90
R9352:Chil3 UTSW 3 106160471 missense probably damaging 1.00
R9607:Chil3 UTSW 3 106160369 missense probably null 0.01
Predicted Primers PCR Primer
(F):5'- ACAAAGTTAGAATTCTATCTTAGGGCC -3'
(R):5'- TTGAACAGACATTGGAGTTCCTAAAAC -3'

Sequencing Primer
(F):5'- AGAATTCTATCTTAGGGCCATTTTCC -3'
(R):5'- CTTTTTGTAGGAAATGCGTA -3'
Posted On 2015-07-21