Mutagenetix > Incidental Mutation

Incidental Mutation 'R4492:Chil3'

330768

Institutional Source

Beutler Lab

Gene Symbol

Chil3

Ensembl Gene

ENSMUSG00000040809

Gene Name

chitinase-like 3

Synonyms

Ym1, Chi3l3

MMRRC Submission

041581-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.571) question?

Stock #

R4492 (G1)

Quality Score

138

Status

Not validated

Chromosome

Chromosomal Location

106147554-106167564 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106155701 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 191 (I191T)

Ref Sequence

ENSEMBL: ENSMUSP00000053923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063062]

AlphaFold

O35744

PDB Structure

THE CRYSTAL STRUCTURE OF NOVEL MAMMALIAN LECTIN YM1 SUGGESTS A SACCHARIDE BINDING SITE [X-RAY DIFFRACTION]
The Crystal Structure of Ym1 at 1.31 A Resolution [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000063062
AA Change: I191T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000053923
Gene: ENSMUSG00000040809
AA Change: I191T

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	365	5.17e-134	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129563

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is similar to bacterial chitinases but lacks chitinase activity. The encoded protein is thought to function as a lectin and may be involved in inflammation and allergy. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr6	T	G	10: 89,725,814	I157L	probably benign	Het
Amph	T	C	13: 19,149,758	V663A	possibly damaging	Het
Anapc16	A	G	10: 59,990,902	S50P	possibly damaging	Het
Ank3	T	A	10: 69,808,925	V60D	probably damaging	Het
Btbd9	A	G	17: 30,527,571	Y94H	probably damaging	Het
Clpb	T	C	7: 101,787,722	L668P	probably damaging	Het
Cyp2d22	G	A	15: 82,374,370	H97Y	probably benign	Het
Dhrs7	A	T	12: 72,653,125	N244K	probably damaging	Het
Dusp4	C	T	8: 34,807,736	T3M	possibly damaging	Het
Edc4	GGATTTTAGCCA	G	8: 105,885,068		probably null	Het
Etl4	G	A	2: 20,806,865	S1621N	possibly damaging	Het
Fam174a	T	C	1: 95,313,976	S54P	probably benign	Het
Fdxacb1	T	C	9: 50,770,247	F7S	probably damaging	Het
Focad	G	A	4: 88,359,905		probably null	Het
Gpr156	T	A	16: 37,992,106	L268H	probably damaging	Het
Gpr17	A	T	18: 31,947,251	I253N	possibly damaging	Het
H2-T23	A	T	17: 36,032,166	N106K	probably damaging	Het
Hspa4	T	C	11: 53,280,469	R303G	probably damaging	Het
Irgm1	G	A	11: 48,866,128		silent	Het
Jph1	A	C	1: 16,997,546	I114S	probably damaging	Het
Kcna1	C	T	6: 126,642,275	D361N	possibly damaging	Het
Kcna4	G	A	2: 107,296,091	R390Q	probably damaging	Het
Lum	C	A	10: 97,568,438	P65H	probably damaging	Het
Mc4r	A	G	18: 66,859,640	L134P	probably benign	Het
Mroh8	A	T	2: 157,258,040	I248N	probably damaging	Het
Nos2	A	G	11: 78,950,095	T677A	probably benign	Het
Nup37	T	A	10: 88,174,929	F257I	possibly damaging	Het
Olfr231	C	T	1: 174,117,204	V271I	probably benign	Het
Olfr273	T	C	4: 52,855,764	I250V	probably benign	Het
Pdzd2	C	T	15: 12,385,637	D1016N	possibly damaging	Het
Pdzd2	A	C	15: 12,419,481	M501R	possibly damaging	Het
Pitx1	T	C	13: 55,828,652	K65E	probably benign	Het
Pla1a	C	T	16: 38,409,610	A247T	probably benign	Het
Prex2	T	A	1: 11,162,263	S851R	probably benign	Het
Prss8	A	G	7: 127,929,807	S26P	probably damaging	Het
Rasef	A	C	4: 73,734,503	L587R	probably damaging	Het
Rock2	T	A	12: 16,977,683	C1334S	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,923		probably benign	Het
Serpina6	A	G	12: 103,646,887	W385R	probably damaging	Het
Slc12a5	T	C	2: 164,979,343	M249T	probably benign	Het
Srsf9	T	A	5: 115,332,592	I117N	probably damaging	Het
Taf1	G	T	X: 101,543,059	M313I	possibly damaging	Het
Tmem30a	T	C	9: 79,777,285	H95R	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc21a	T	C	9: 119,941,280	V139A	probably benign	Het
Zfp236	A	T	18: 82,630,000	V1012D	probably damaging	Het
Zfp612	C	A	8: 110,089,297	Q379K	probably damaging	Het
Zfp930	C	T	8: 69,228,246	Q198*	probably null	Het

Other mutations in Chil3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Chil3	APN	3	106148701	missense	probably damaging	1.00
IGL01552:Chil3	APN	3	106148848	missense	probably damaging	0.98
IGL02538:Chil3	APN	3	106164129	missense	probably damaging	1.00
PIT4382001:Chil3	UTSW	3	106148659	missense	probably damaging	1.00
R0145:Chil3	UTSW	3	106160478	missense	probably damaging	1.00
R0269:Chil3	UTSW	3	106155756	missense	probably benign	0.00
R0310:Chil3	UTSW	3	106160523	missense	possibly damaging	0.75
R0453:Chil3	UTSW	3	106148905	missense	probably benign	0.26
R0541:Chil3	UTSW	3	106161232	critical splice acceptor site	probably null
R0617:Chil3	UTSW	3	106155756	missense	probably benign	0.00
R0831:Chil3	UTSW	3	106149747	missense	probably benign	0.19
R1699:Chil3	UTSW	3	106160366	critical splice donor site	probably null
R1851:Chil3	UTSW	3	106148801	critical splice donor site	probably null
R1852:Chil3	UTSW	3	106148801	critical splice donor site	probably null
R2105:Chil3	UTSW	3	106160478	missense	possibly damaging	0.73
R2202:Chil3	UTSW	3	106164246	missense	probably benign	0.11
R2204:Chil3	UTSW	3	106164246	missense	probably benign	0.11
R2205:Chil3	UTSW	3	106164246	missense	probably benign	0.11
R4358:Chil3	UTSW	3	106160499	nonsense	probably null
R4543:Chil3	UTSW	3	106160370	missense	probably benign
R4554:Chil3	UTSW	3	106160370	missense	probably benign
R4930:Chil3	UTSW	3	106164208	missense	possibly damaging	0.67
R5011:Chil3	UTSW	3	106150161	missense	possibly damaging	0.46
R5083:Chil3	UTSW	3	106164089	critical splice donor site	probably null
R5231:Chil3	UTSW	3	106155729	missense	probably damaging	0.96
R5423:Chil3	UTSW	3	106148662	missense	probably damaging	1.00
R6804:Chil3	UTSW	3	106164179	nonsense	probably null
R6859:Chil3	UTSW	3	106160414	missense	probably benign	0.14
R7218:Chil3	UTSW	3	106160537	splice site	probably null
R7391:Chil3	UTSW	3	106164180	missense	probably damaging	1.00
R7426:Chil3	UTSW	3	106155706	missense	probably benign	0.05
R7582:Chil3	UTSW	3	106164256	missense	probably damaging	1.00
R7620:Chil3	UTSW	3	106160435	missense	probably damaging	1.00
R7647:Chil3	UTSW	3	106148806	missense	possibly damaging	0.73
R7749:Chil3	UTSW	3	106148845	missense	probably benign	0.22
R7944:Chil3	UTSW	3	106150148	nonsense	probably null
R8099:Chil3	UTSW	3	106148668	missense	probably damaging	1.00
R8181:Chil3	UTSW	3	106149887	missense	probably damaging	0.98
R8859:Chil3	UTSW	3	106164124	missense	possibly damaging	0.86
R9011:Chil3	UTSW	3	106149715	nonsense	probably null
R9193:Chil3	UTSW	3	106155765	missense	possibly damaging	0.90
R9352:Chil3	UTSW	3	106160471	missense	probably damaging	1.00
R9607:Chil3	UTSW	3	106160369	missense	probably null	0.01

Predicted Primers

PCR Primer
(F):5'- ACAAAGTTAGAATTCTATCTTAGGGCC -3'
(R):5'- TTGAACAGACATTGGAGTTCCTAAAAC -3'

Sequencing Primer
(F):5'- AGAATTCTATCTTAGGGCCATTTTCC -3'
(R):5'- CTTTTTGTAGGAAATGCGTA -3'

Posted On

2015-07-21