Incidental Mutation 'R4492:Rasef'
ID330771
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene NameRAS and EF hand domain containing
SynonymsRAB45
MMRRC Submission 041581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4492 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location73714579-73790994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73734503 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 587 (L587R)
Ref Sequence ENSEMBL: ENSMUSP00000152127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
Predicted Effect probably damaging
Transcript: ENSMUST00000058292
AA Change: L506R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: L506R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102837
AA Change: L434R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: L434R

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222414
AA Change: L587R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T G 10: 89,725,814 I157L probably benign Het
Amph T C 13: 19,149,758 V663A possibly damaging Het
Anapc16 A G 10: 59,990,902 S50P possibly damaging Het
Ank3 T A 10: 69,808,925 V60D probably damaging Het
Btbd9 A G 17: 30,527,571 Y94H probably damaging Het
Chil3 A G 3: 106,155,701 I191T probably damaging Het
Clpb T C 7: 101,787,722 L668P probably damaging Het
Cyp2d22 G A 15: 82,374,370 H97Y probably benign Het
Dhrs7 A T 12: 72,653,125 N244K probably damaging Het
Dusp4 C T 8: 34,807,736 T3M possibly damaging Het
Edc4 GGATTTTAGCCA G 8: 105,885,068 probably null Het
Etl4 G A 2: 20,806,865 S1621N possibly damaging Het
Fam174a T C 1: 95,313,976 S54P probably benign Het
Fdxacb1 T C 9: 50,770,247 F7S probably damaging Het
Focad G A 4: 88,359,905 probably null Het
Gpr156 T A 16: 37,992,106 L268H probably damaging Het
Gpr17 A T 18: 31,947,251 I253N possibly damaging Het
H2-T23 A T 17: 36,032,166 N106K probably damaging Het
Hspa4 T C 11: 53,280,469 R303G probably damaging Het
Irgm1 G A 11: 48,866,128 silent Het
Jph1 A C 1: 16,997,546 I114S probably damaging Het
Kcna1 C T 6: 126,642,275 D361N possibly damaging Het
Kcna4 G A 2: 107,296,091 R390Q probably damaging Het
Lum C A 10: 97,568,438 P65H probably damaging Het
Mc4r A G 18: 66,859,640 L134P probably benign Het
Mroh8 A T 2: 157,258,040 I248N probably damaging Het
Nos2 A G 11: 78,950,095 T677A probably benign Het
Nup37 T A 10: 88,174,929 F257I possibly damaging Het
Olfr231 C T 1: 174,117,204 V271I probably benign Het
Olfr273 T C 4: 52,855,764 I250V probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pdzd2 A C 15: 12,419,481 M501R possibly damaging Het
Pitx1 T C 13: 55,828,652 K65E probably benign Het
Pla1a C T 16: 38,409,610 A247T probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Prss8 A G 7: 127,929,807 S26P probably damaging Het
Rock2 T A 12: 16,977,683 C1334S probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Serpina6 A G 12: 103,646,887 W385R probably damaging Het
Slc12a5 T C 2: 164,979,343 M249T probably benign Het
Srsf9 T A 5: 115,332,592 I117N probably damaging Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc21a T C 9: 119,941,280 V139A probably benign Het
Zfp236 A T 18: 82,630,000 V1012D probably damaging Het
Zfp612 C A 8: 110,089,297 Q379K probably damaging Het
Zfp930 C T 8: 69,228,246 Q198* probably null Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73771425 nonsense probably null
IGL01329:Rasef APN 4 73727645 missense probably damaging 1.00
IGL01517:Rasef APN 4 73769822 missense probably benign 0.03
IGL02465:Rasef APN 4 73734488 missense probably damaging 1.00
IGL02676:Rasef APN 4 73759729 missense possibly damaging 0.69
IGL03137:Rasef APN 4 73734483 nonsense probably null
IGL03403:Rasef APN 4 73734534 missense probably damaging 1.00
BB001:Rasef UTSW 4 73740929 critical splice donor site
BB011:Rasef UTSW 4 73740929 critical splice donor site
P0033:Rasef UTSW 4 73749852 missense probably benign 0.26
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0317:Rasef UTSW 4 73748562 missense probably damaging 1.00
R0686:Rasef UTSW 4 73734534 missense probably damaging 1.00
R0987:Rasef UTSW 4 73734484 nonsense probably null
R1115:Rasef UTSW 4 73748604 missense possibly damaging 0.85
R1511:Rasef UTSW 4 73735748 missense probably damaging 1.00
R1585:Rasef UTSW 4 73740337 missense probably damaging 1.00
R1646:Rasef UTSW 4 73734549 missense probably damaging 1.00
R1705:Rasef UTSW 4 73744064 nonsense probably null
R1918:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R1919:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R3819:Rasef UTSW 4 73759705 missense probably damaging 1.00
R3891:Rasef UTSW 4 73780397 missense probably benign 0.03
R3892:Rasef UTSW 4 73780397 missense probably benign 0.03
R4344:Rasef UTSW 4 73745089 missense probably damaging 1.00
R4491:Rasef UTSW 4 73734503 missense probably damaging 1.00
R4594:Rasef UTSW 4 73780389 missense possibly damaging 0.47
R4915:Rasef UTSW 4 73731459 missense probably damaging 1.00
R5276:Rasef UTSW 4 73735767 missense probably null 1.00
R5359:Rasef UTSW 4 73771328 missense probably damaging 1.00
R5682:Rasef UTSW 4 73740971 nonsense probably null
R5693:Rasef UTSW 4 73769839 missense probably damaging 0.99
R6414:Rasef UTSW 4 73740581 missense probably benign 0.13
R6543:Rasef UTSW 4 73780519 intron probably benign
R6593:Rasef UTSW 4 73745090 missense probably damaging 1.00
R7078:Rasef UTSW 4 73780389 missense probably benign 0.01
R7083:Rasef UTSW 4 73790984 missense probably benign 0.26
R7106:Rasef UTSW 4 73727627 missense probably damaging 1.00
R7127:Rasef UTSW 4 73744132 missense probably damaging 1.00
R7329:Rasef UTSW 4 73744137 missense probably damaging 1.00
R7767:Rasef UTSW 4 73734534 missense probably damaging 1.00
R7891:Rasef UTSW 4 73759698 missense probably benign 0.00
R7891:Rasef UTSW 4 73790964 missense probably benign
R7974:Rasef UTSW 4 73759698 missense probably benign 0.00
R7974:Rasef UTSW 4 73790964 missense probably benign
R7997:Rasef UTSW 4 73740562 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AAGGCTGCAGAGGTCACTAG -3'
(R):5'- TGGACAAAGGATAGGCTTCTTCAG -3'

Sequencing Primer
(F):5'- GAGGTCACTAGCGCCTAATC -3'
(R):5'- GCTTCTTCAGCGCTCTTAATGAAG -3'
Posted On2015-07-21