Incidental Mutation 'R4492:Clpb'
ID330778
Institutional Source Beutler Lab
Gene Symbol Clpb
Ensembl Gene ENSMUSG00000001829
Gene NameClpB caseinolytic peptidase B
SynonymsSkd3
MMRRC Submission 041581-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R4492 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101663633-101795506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101787722 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 668 (L668P)
Ref Sequence ENSEMBL: ENSMUSP00000148062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001884] [ENSMUST00000106998] [ENSMUST00000209579]
Predicted Effect probably damaging
Transcript: ENSMUST00000001884
AA Change: L668P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001884
Gene: ENSMUSG00000001829
AA Change: L668P

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 235 264 6.65e-6 SMART
low complexity region 294 306 N/A INTRINSIC
AAA 343 497 6.36e-10 SMART
ClpB_D2-small 541 630 6.83e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106998
AA Change: L698P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102611
Gene: ENSMUSG00000001829
AA Change: L698P

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 265 294 6.65e-6 SMART
low complexity region 324 336 N/A INTRINSIC
AAA 373 527 6.36e-10 SMART
ClpB_D2-small 571 660 6.83e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150832
Predicted Effect probably damaging
Transcript: ENSMUST00000209579
AA Change: L668P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210465
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T G 10: 89,725,814 I157L probably benign Het
Amph T C 13: 19,149,758 V663A possibly damaging Het
Anapc16 A G 10: 59,990,902 S50P possibly damaging Het
Ank3 T A 10: 69,808,925 V60D probably damaging Het
Btbd9 A G 17: 30,527,571 Y94H probably damaging Het
Chil3 A G 3: 106,155,701 I191T probably damaging Het
Cyp2d22 G A 15: 82,374,370 H97Y probably benign Het
Dhrs7 A T 12: 72,653,125 N244K probably damaging Het
Dusp4 C T 8: 34,807,736 T3M possibly damaging Het
Edc4 GGATTTTAGCCA G 8: 105,885,068 probably null Het
Etl4 G A 2: 20,806,865 S1621N possibly damaging Het
Fam174a T C 1: 95,313,976 S54P probably benign Het
Fdxacb1 T C 9: 50,770,247 F7S probably damaging Het
Focad G A 4: 88,359,905 probably null Het
Gpr156 T A 16: 37,992,106 L268H probably damaging Het
Gpr17 A T 18: 31,947,251 I253N possibly damaging Het
H2-T23 A T 17: 36,032,166 N106K probably damaging Het
Hspa4 T C 11: 53,280,469 R303G probably damaging Het
Irgm1 G A 11: 48,866,128 silent Het
Jph1 A C 1: 16,997,546 I114S probably damaging Het
Kcna1 C T 6: 126,642,275 D361N possibly damaging Het
Kcna4 G A 2: 107,296,091 R390Q probably damaging Het
Lum C A 10: 97,568,438 P65H probably damaging Het
Mc4r A G 18: 66,859,640 L134P probably benign Het
Mroh8 A T 2: 157,258,040 I248N probably damaging Het
Nos2 A G 11: 78,950,095 T677A probably benign Het
Nup37 T A 10: 88,174,929 F257I possibly damaging Het
Olfr231 C T 1: 174,117,204 V271I probably benign Het
Olfr273 T C 4: 52,855,764 I250V probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pdzd2 A C 15: 12,419,481 M501R possibly damaging Het
Pitx1 T C 13: 55,828,652 K65E probably benign Het
Pla1a C T 16: 38,409,610 A247T probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Prss8 A G 7: 127,929,807 S26P probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rock2 T A 12: 16,977,683 C1334S probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Serpina6 A G 12: 103,646,887 W385R probably damaging Het
Slc12a5 T C 2: 164,979,343 M249T probably benign Het
Srsf9 T A 5: 115,332,592 I117N probably damaging Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc21a T C 9: 119,941,280 V139A probably benign Het
Zfp236 A T 18: 82,630,000 V1012D probably damaging Het
Zfp612 C A 8: 110,089,297 Q379K probably damaging Het
Zfp930 C T 8: 69,228,246 Q198* probably null Het
Other mutations in Clpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Clpb APN 7 101787745 missense probably benign
IGL00778:Clpb APN 7 101778608 nonsense probably null
IGL00780:Clpb APN 7 101778608 nonsense probably null
IGL00951:Clpb APN 7 101751260 missense probably benign 0.00
IGL01374:Clpb APN 7 101773128 missense probably damaging 1.00
IGL01542:Clpb APN 7 101787505 missense probably damaging 0.98
IGL02203:Clpb APN 7 101779337 missense probably damaging 1.00
IGL02989:Clpb APN 7 101779220 missense probably damaging 1.00
IGL03088:Clpb APN 7 101785449 nonsense probably null
Surfeit UTSW 7 101711465 missense probably damaging 1.00
PIT1430001:Clpb UTSW 7 101786719 missense possibly damaging 0.95
PIT4486001:Clpb UTSW 7 101663932 missense probably benign 0.17
R0611:Clpb UTSW 7 101787749 missense possibly damaging 0.71
R1565:Clpb UTSW 7 101785461 missense probably benign 0.00
R1760:Clpb UTSW 7 101786698 missense possibly damaging 0.92
R1879:Clpb UTSW 7 101706483 missense probably benign 0.23
R1933:Clpb UTSW 7 101779211 missense probably damaging 0.96
R1938:Clpb UTSW 7 101763656 missense probably damaging 1.00
R2922:Clpb UTSW 7 101722828 missense probably benign 0.02
R2923:Clpb UTSW 7 101722828 missense probably benign 0.02
R2995:Clpb UTSW 7 101779324 missense probably damaging 1.00
R5384:Clpb UTSW 7 101779341 missense probably damaging 1.00
R5973:Clpb UTSW 7 101663997 missense probably benign 0.02
R6787:Clpb UTSW 7 101663659 unclassified probably benign
R7158:Clpb UTSW 7 101663832 missense probably benign 0.45
R7225:Clpb UTSW 7 101711465 missense probably damaging 1.00
R7239:Clpb UTSW 7 101711455 missense probably damaging 0.96
R7482:Clpb UTSW 7 101786719 missense possibly damaging 0.95
R7499:Clpb UTSW 7 101722728 missense possibly damaging 0.92
R7547:Clpb UTSW 7 101664296 intron probably null
R7769:Clpb UTSW 7 101722717 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGAGCGGCGTGTGGTAAAC -3'
(R):5'- GTTCCTTGCCTTGGAGATCATAACAG -3'

Sequencing Primer
(F):5'- TGGTAAACCAACTGGCGGC -3'
(R):5'- GCCTTGGAGATCATAACAGACTATG -3'
Posted On2015-07-21