Incidental Mutation 'R4492:Tmem30a'
ID330785
Institutional Source Beutler Lab
Gene Symbol Tmem30a
Ensembl Gene ENSMUSG00000032328
Gene Nametransmembrane protein 30A
SynonymsCdc50a, D9Wsu20e, 2010200I23Rik
MMRRC Submission 041581-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4492 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location79768943-79793507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79777285 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 95 (H95R)
Ref Sequence ENSEMBL: ENSMUSP00000114042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034878] [ENSMUST00000120690]
Predicted Effect probably damaging
Transcript: ENSMUST00000034878
AA Change: H131R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034878
Gene: ENSMUSG00000032328
AA Change: H131R

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:CDC50 69 358 1.3e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120690
AA Change: H95R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114042
Gene: ENSMUSG00000032328
AA Change: H95R

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:CDC50 50 325 3.4e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153815
Meta Mutation Damage Score 0.9437 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Conditional homozygous knockout in the liver leads to jaundice, increased bilirubin and bile salt levels, liver inflammation and liver fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T G 10: 89,725,814 I157L probably benign Het
Amph T C 13: 19,149,758 V663A possibly damaging Het
Anapc16 A G 10: 59,990,902 S50P possibly damaging Het
Ank3 T A 10: 69,808,925 V60D probably damaging Het
Btbd9 A G 17: 30,527,571 Y94H probably damaging Het
Chil3 A G 3: 106,155,701 I191T probably damaging Het
Clpb T C 7: 101,787,722 L668P probably damaging Het
Cyp2d22 G A 15: 82,374,370 H97Y probably benign Het
Dhrs7 A T 12: 72,653,125 N244K probably damaging Het
Dusp4 C T 8: 34,807,736 T3M possibly damaging Het
Edc4 GGATTTTAGCCA G 8: 105,885,068 probably null Het
Etl4 G A 2: 20,806,865 S1621N possibly damaging Het
Fam174a T C 1: 95,313,976 S54P probably benign Het
Fdxacb1 T C 9: 50,770,247 F7S probably damaging Het
Focad G A 4: 88,359,905 probably null Het
Gpr156 T A 16: 37,992,106 L268H probably damaging Het
Gpr17 A T 18: 31,947,251 I253N possibly damaging Het
H2-T23 A T 17: 36,032,166 N106K probably damaging Het
Hspa4 T C 11: 53,280,469 R303G probably damaging Het
Irgm1 G A 11: 48,866,128 silent Het
Jph1 A C 1: 16,997,546 I114S probably damaging Het
Kcna1 C T 6: 126,642,275 D361N possibly damaging Het
Kcna4 G A 2: 107,296,091 R390Q probably damaging Het
Lum C A 10: 97,568,438 P65H probably damaging Het
Mc4r A G 18: 66,859,640 L134P probably benign Het
Mroh8 A T 2: 157,258,040 I248N probably damaging Het
Nos2 A G 11: 78,950,095 T677A probably benign Het
Nup37 T A 10: 88,174,929 F257I possibly damaging Het
Olfr231 C T 1: 174,117,204 V271I probably benign Het
Olfr273 T C 4: 52,855,764 I250V probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pdzd2 A C 15: 12,419,481 M501R possibly damaging Het
Pitx1 T C 13: 55,828,652 K65E probably benign Het
Pla1a C T 16: 38,409,610 A247T probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Prss8 A G 7: 127,929,807 S26P probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rock2 T A 12: 16,977,683 C1334S probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Serpina6 A G 12: 103,646,887 W385R probably damaging Het
Slc12a5 T C 2: 164,979,343 M249T probably benign Het
Srsf9 T A 5: 115,332,592 I117N probably damaging Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc21a T C 9: 119,941,280 V139A probably benign Het
Zfp236 A T 18: 82,630,000 V1012D probably damaging Het
Zfp612 C A 8: 110,089,297 Q379K probably damaging Het
Zfp930 C T 8: 69,228,246 Q198* probably null Het
Other mutations in Tmem30a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Tmem30a APN 9 79775100 critical splice donor site probably null
IGL01701:Tmem30a APN 9 79774179 missense probably damaging 1.00
IGL02043:Tmem30a APN 9 79774089 splice site probably benign
IGL02319:Tmem30a APN 9 79774203 missense probably damaging 1.00
IGL02629:Tmem30a APN 9 79776249 splice site probably benign
IGL02983:Tmem30a APN 9 79771443 missense possibly damaging 0.90
Imbroglio UTSW 9 79774265 nonsense probably null
R0085:Tmem30a UTSW 9 79771294 missense probably benign 0.02
R0496:Tmem30a UTSW 9 79777285 missense probably damaging 1.00
R0498:Tmem30a UTSW 9 79774094 nonsense probably null
R1546:Tmem30a UTSW 9 79771288 makesense probably null
R1648:Tmem30a UTSW 9 79793029 missense probably damaging 1.00
R2018:Tmem30a UTSW 9 79774218 missense probably damaging 1.00
R2019:Tmem30a UTSW 9 79774218 missense probably damaging 1.00
R2259:Tmem30a UTSW 9 79774164 missense probably benign 0.13
R2260:Tmem30a UTSW 9 79774164 missense probably benign 0.13
R4491:Tmem30a UTSW 9 79777285 missense probably damaging 1.00
R5289:Tmem30a UTSW 9 79776154 missense probably damaging 0.99
R5433:Tmem30a UTSW 9 79780648 missense probably damaging 0.98
R6707:Tmem30a UTSW 9 79774265 nonsense probably null
R7662:Tmem30a UTSW 9 79775231 missense probably benign
R7732:Tmem30a UTSW 9 79780544 missense possibly damaging 0.49
R8100:Tmem30a UTSW 9 79774150 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTATTTTGTGGGCATTCAAG -3'
(R):5'- GTTGCTACTTAACCTCAGTACCTG -3'

Sequencing Primer
(F):5'- TTTGTGGGCATTCAAGAAAAAGC -3'
(R):5'- GTTAAAAGGTTTTCCCTTTCTG -3'
Posted On2015-07-21