Incidental Mutation 'R4492:Serpina6'
ID330798
Institutional Source Beutler Lab
Gene Symbol Serpina6
Ensembl Gene ENSMUSG00000060807
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 6
SynonymsCbg
MMRRC Submission 041581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4492 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location103646630-103657212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103646887 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 385 (W385R)
Ref Sequence ENSEMBL: ENSMUSP00000044033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044159]
Predicted Effect probably damaging
Transcript: ENSMUST00000044159
AA Change: W385R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044033
Gene: ENSMUSG00000060807
AA Change: W385R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 43 396 3.45e-160 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185363
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the serpin (serine protease inhibitor) family. The encoded protein is an alpha-globulin with corticosteroid-binding properties. This is the major transport protein for glucorticoids and progestins in the blood of most vertebrates. The gene localizes to a chromosomal region containing several closely related serine protease inhibitors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null homozygotes exhibit reduced total plasma corticosterone, increased susceptibility to bacterial infection, attenuation of the stress-induced surge in free corticosterone, and enhanced behavioral response to intense or uncontrollable stress. They exhibit no locomotor sensitization to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T G 10: 89,725,814 I157L probably benign Het
Amph T C 13: 19,149,758 V663A possibly damaging Het
Anapc16 A G 10: 59,990,902 S50P possibly damaging Het
Ank3 T A 10: 69,808,925 V60D probably damaging Het
Btbd9 A G 17: 30,527,571 Y94H probably damaging Het
Chil3 A G 3: 106,155,701 I191T probably damaging Het
Clpb T C 7: 101,787,722 L668P probably damaging Het
Cyp2d22 G A 15: 82,374,370 H97Y probably benign Het
Dhrs7 A T 12: 72,653,125 N244K probably damaging Het
Dusp4 C T 8: 34,807,736 T3M possibly damaging Het
Edc4 GGATTTTAGCCA G 8: 105,885,068 probably null Het
Etl4 G A 2: 20,806,865 S1621N possibly damaging Het
Fam174a T C 1: 95,313,976 S54P probably benign Het
Fdxacb1 T C 9: 50,770,247 F7S probably damaging Het
Focad G A 4: 88,359,905 probably null Het
Gpr156 T A 16: 37,992,106 L268H probably damaging Het
Gpr17 A T 18: 31,947,251 I253N possibly damaging Het
H2-T23 A T 17: 36,032,166 N106K probably damaging Het
Hspa4 T C 11: 53,280,469 R303G probably damaging Het
Irgm1 G A 11: 48,866,128 silent Het
Jph1 A C 1: 16,997,546 I114S probably damaging Het
Kcna1 C T 6: 126,642,275 D361N possibly damaging Het
Kcna4 G A 2: 107,296,091 R390Q probably damaging Het
Lum C A 10: 97,568,438 P65H probably damaging Het
Mc4r A G 18: 66,859,640 L134P probably benign Het
Mroh8 A T 2: 157,258,040 I248N probably damaging Het
Nos2 A G 11: 78,950,095 T677A probably benign Het
Nup37 T A 10: 88,174,929 F257I possibly damaging Het
Olfr231 C T 1: 174,117,204 V271I probably benign Het
Olfr273 T C 4: 52,855,764 I250V probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pdzd2 A C 15: 12,419,481 M501R possibly damaging Het
Pitx1 T C 13: 55,828,652 K65E probably benign Het
Pla1a C T 16: 38,409,610 A247T probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Prss8 A G 7: 127,929,807 S26P probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rock2 T A 12: 16,977,683 C1334S probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Slc12a5 T C 2: 164,979,343 M249T probably benign Het
Srsf9 T A 5: 115,332,592 I117N probably damaging Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc21a T C 9: 119,941,280 V139A probably benign Het
Zfp236 A T 18: 82,630,000 V1012D probably damaging Het
Zfp612 C A 8: 110,089,297 Q379K probably damaging Het
Zfp930 C T 8: 69,228,246 Q198* probably null Het
Other mutations in Serpina6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Serpina6 APN 12 103651903 missense probably damaging 1.00
IGL00910:Serpina6 APN 12 103651965 unclassified probably benign
IGL01512:Serpina6 APN 12 103654059 missense probably damaging 0.96
IGL02994:Serpina6 APN 12 103653951 missense probably benign 0.03
IGL03092:Serpina6 APN 12 103653895 critical splice donor site probably null
IGL03351:Serpina6 APN 12 103646913 missense probably damaging 1.00
R0178:Serpina6 UTSW 12 103646913 missense probably damaging 0.98
R0362:Serpina6 UTSW 12 103651949 missense probably damaging 0.98
R0530:Serpina6 UTSW 12 103651794 missense probably damaging 1.00
R1542:Serpina6 UTSW 12 103654473 missense probably benign 0.09
R1573:Serpina6 UTSW 12 103651753 missense probably damaging 1.00
R1764:Serpina6 UTSW 12 103653923 missense probably damaging 1.00
R2243:Serpina6 UTSW 12 103646928 missense probably benign 0.00
R2309:Serpina6 UTSW 12 103654179 missense probably benign 0.00
R2363:Serpina6 UTSW 12 103648609 missense probably benign 0.00
R3691:Serpina6 UTSW 12 103654409 missense probably benign 0.00
R4498:Serpina6 UTSW 12 103654067 missense probably benign 0.02
R4953:Serpina6 UTSW 12 103651962 critical splice acceptor site probably null
R4985:Serpina6 UTSW 12 103653936 missense probably benign 0.00
R5022:Serpina6 UTSW 12 103651712 missense probably damaging 1.00
R5230:Serpina6 UTSW 12 103651898 missense probably benign 0.18
R5318:Serpina6 UTSW 12 103653962 missense possibly damaging 0.68
R5350:Serpina6 UTSW 12 103648579 missense possibly damaging 0.68
R5569:Serpina6 UTSW 12 103654460 missense possibly damaging 0.90
R5664:Serpina6 UTSW 12 103654467 missense probably damaging 0.97
R5882:Serpina6 UTSW 12 103654235 missense probably benign 0.00
R6275:Serpina6 UTSW 12 103648720 missense probably benign 0.01
R6364:Serpina6 UTSW 12 103654236 missense probably benign
R7173:Serpina6 UTSW 12 103646994 missense possibly damaging 0.78
R7181:Serpina6 UTSW 12 103646944 missense probably benign 0.00
R7725:Serpina6 UTSW 12 103648677 nonsense probably null
R7811:Serpina6 UTSW 12 103654136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTAGCAACAAGGCCTATTCATTAC -3'
(R):5'- AGATGTGAGCAGCTCCTGTC -3'

Sequencing Primer
(F):5'- CAAGGCCTATTCATTACAAGATGTC -3'
(R):5'- GACAGGGATTTATCTCCTGCC -3'
Posted On2015-07-21