Mutagenetix > Incidental Mutation

Incidental Mutation 'R4492:Amph'

330799

Institutional Source

Beutler Lab

Gene Symbol

Amph

Ensembl Gene

ENSMUSG00000021314

Gene Name

amphiphysin

Synonyms

MMRRC Submission

041581-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.364) question?

Stock #

R4492 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18948205-19150921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19149758 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 663 (V663A)

Ref Sequence

ENSEMBL: ENSMUSP00000142766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]

AlphaFold

Q7TQF7

Predicted Effect

probably benign
Transcript: ENSMUST00000003345
AA Change: V659A

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: V659A

Domain	Start	End	E-Value	Type
BAR	12	233	8.47e-80	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	424	445	N/A	INTRINSIC
low complexity region	479	499	N/A	INTRINSIC
SH3	616	686	7.82e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200466
AA Change: V663A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: V663A

Domain	Start	End	E-Value	Type
BAR	12	233	2.3e-82	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	428	449	N/A	INTRINSIC
low complexity region	483	503	N/A	INTRINSIC
SH3	620	690	4.9e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222698

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr6	T	G	10: 89,725,814	I157L	probably benign	Het
Anapc16	A	G	10: 59,990,902	S50P	possibly damaging	Het
Ank3	T	A	10: 69,808,925	V60D	probably damaging	Het
Btbd9	A	G	17: 30,527,571	Y94H	probably damaging	Het
Chil3	A	G	3: 106,155,701	I191T	probably damaging	Het
Clpb	T	C	7: 101,787,722	L668P	probably damaging	Het
Cyp2d22	G	A	15: 82,374,370	H97Y	probably benign	Het
Dhrs7	A	T	12: 72,653,125	N244K	probably damaging	Het
Dusp4	C	T	8: 34,807,736	T3M	possibly damaging	Het
Edc4	GGATTTTAGCCA	G	8: 105,885,068		probably null	Het
Etl4	G	A	2: 20,806,865	S1621N	possibly damaging	Het
Fam174a	T	C	1: 95,313,976	S54P	probably benign	Het
Fdxacb1	T	C	9: 50,770,247	F7S	probably damaging	Het
Focad	G	A	4: 88,359,905		probably null	Het
Gpr156	T	A	16: 37,992,106	L268H	probably damaging	Het
Gpr17	A	T	18: 31,947,251	I253N	possibly damaging	Het
H2-T23	A	T	17: 36,032,166	N106K	probably damaging	Het
Hspa4	T	C	11: 53,280,469	R303G	probably damaging	Het
Irgm1	G	A	11: 48,866,128		silent	Het
Jph1	A	C	1: 16,997,546	I114S	probably damaging	Het
Kcna1	C	T	6: 126,642,275	D361N	possibly damaging	Het
Kcna4	G	A	2: 107,296,091	R390Q	probably damaging	Het
Lum	C	A	10: 97,568,438	P65H	probably damaging	Het
Mc4r	A	G	18: 66,859,640	L134P	probably benign	Het
Mroh8	A	T	2: 157,258,040	I248N	probably damaging	Het
Nos2	A	G	11: 78,950,095	T677A	probably benign	Het
Nup37	T	A	10: 88,174,929	F257I	possibly damaging	Het
Olfr231	C	T	1: 174,117,204	V271I	probably benign	Het
Olfr273	T	C	4: 52,855,764	I250V	probably benign	Het
Pdzd2	C	T	15: 12,385,637	D1016N	possibly damaging	Het
Pdzd2	A	C	15: 12,419,481	M501R	possibly damaging	Het
Pitx1	T	C	13: 55,828,652	K65E	probably benign	Het
Pla1a	C	T	16: 38,409,610	A247T	probably benign	Het
Prex2	T	A	1: 11,162,263	S851R	probably benign	Het
Prss8	A	G	7: 127,929,807	S26P	probably damaging	Het
Rasef	A	C	4: 73,734,503	L587R	probably damaging	Het
Rock2	T	A	12: 16,977,683	C1334S	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,923		probably benign	Het
Serpina6	A	G	12: 103,646,887	W385R	probably damaging	Het
Slc12a5	T	C	2: 164,979,343	M249T	probably benign	Het
Srsf9	T	A	5: 115,332,592	I117N	probably damaging	Het
Taf1	G	T	X: 101,543,059	M313I	possibly damaging	Het
Tmem30a	T	C	9: 79,777,285	H95R	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc21a	T	C	9: 119,941,280	V139A	probably benign	Het
Zfp236	A	T	18: 82,630,000	V1012D	probably damaging	Het
Zfp612	C	A	8: 110,089,297	Q379K	probably damaging	Het
Zfp930	C	T	8: 69,228,246	Q198*	probably null	Het

Other mutations in Amph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Amph	APN	13	19120606	missense	probably damaging	1.00
IGL01866:Amph	APN	13	19142002	missense	probably damaging	1.00
IGL02157:Amph	APN	13	19104231	missense	possibly damaging	0.60
IGL02300:Amph	APN	13	19086604	missense	probably damaging	1.00
IGL02435:Amph	APN	13	19139163	splice site	probably benign
IGL03060:Amph	APN	13	19094814	missense	probably damaging	0.99
IGL03122:Amph	APN	13	19102943	missense	probably damaging	0.98
R0037:Amph	UTSW	13	19100653	missense	possibly damaging	0.90
R0646:Amph	UTSW	13	19113116	missense	possibly damaging	0.95
R0652:Amph	UTSW	13	19086621	splice site	probably null
R1005:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1199:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1200:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1201:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1333:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1334:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1335:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1337:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1338:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1384:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1397:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1501:Amph	UTSW	13	19104291	nonsense	probably null
R1528:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1822:Amph	UTSW	13	18948455	missense	probably damaging	0.98
R2004:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2061:Amph	UTSW	13	19125035	nonsense	probably null
R2111:Amph	UTSW	13	19116266	splice site	probably benign
R2329:Amph	UTSW	13	19139350	missense	probably benign
R2878:Amph	UTSW	13	19104267	missense	possibly damaging	0.95
R3121:Amph	UTSW	13	19113146	nonsense	probably null
R3548:Amph	UTSW	13	19102959	missense	probably damaging	1.00
R4059:Amph	UTSW	13	19141998	missense	probably damaging	1.00
R4369:Amph	UTSW	13	19137700	missense	probably benign	0.20
R4855:Amph	UTSW	13	19084208	missense	probably damaging	1.00
R4937:Amph	UTSW	13	19104345	missense	probably damaging	1.00
R4965:Amph	UTSW	13	19137699	missense	probably benign	0.12
R5777:Amph	UTSW	13	19046016	missense	probably damaging	1.00
R5787:Amph	UTSW	13	18948454	missense	possibly damaging	0.75
R6091:Amph	UTSW	13	19125123	missense	probably benign	0.01
R7100:Amph	UTSW	13	19149841	makesense	probably null
R7103:Amph	UTSW	13	19149738	missense	probably benign	0.00
R7451:Amph	UTSW	13	19077368	missense	probably damaging	1.00
R7522:Amph	UTSW	13	19086545	missense	probably damaging	0.96
R8165:Amph	UTSW	13	19094837	missense	probably benign	0.05
R8166:Amph	UTSW	13	18948490	missense	possibly damaging	0.91
R8214:Amph	UTSW	13	19104298	missense	possibly damaging	0.81
R9021:Amph	UTSW	13	19099901	missense	probably benign	0.35
R9241:Amph	UTSW	13	19094802	missense	probably damaging	1.00
R9469:Amph	UTSW	13	19086599	missense	probably damaging	1.00
R9717:Amph	UTSW	13	19125083	missense	probably benign	0.07
R9755:Amph	UTSW	13	19113155	missense	probably damaging	1.00
V1662:Amph	UTSW	13	19139370	missense	probably benign	0.36
Z1177:Amph	UTSW	13	19139334	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- CTCAGGTAATGCTAACTCAATAGTCC -3'
(R):5'- GGCACCAGTCTGTCAATCATG -3'

Sequencing Primer
(F):5'- GTCCCAGTACTAGCTGAATG -3'
(R):5'- CACCAGTCTGTCAATCATGAAGAGTG -3'

Posted On

2015-07-21