Incidental Mutation 'R4492:Cyp2d22'
ID 330804
Institutional Source Beutler Lab
Gene Symbol Cyp2d22
Ensembl Gene ENSMUSG00000061740
Gene Name cytochrome P450, family 2, subfamily d, polypeptide 22
Synonyms 2D22
MMRRC Submission 041581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R4492 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 82370527-82380260 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 82374370 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 97 (H97Y)
Ref Sequence ENSEMBL: ENSMUSP00000023083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023083] [ENSMUST00000228986]
AlphaFold Q9JKY7
Predicted Effect probably benign
Transcript: ENSMUST00000023083
AA Change: H97Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023083
Gene: ENSMUSG00000061740
AA Change: H97Y

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:p450 37 497 8.1e-139 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000228986
AA Change: H70Y
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230663
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T G 10: 89,725,814 I157L probably benign Het
Amph T C 13: 19,149,758 V663A possibly damaging Het
Anapc16 A G 10: 59,990,902 S50P possibly damaging Het
Ank3 T A 10: 69,808,925 V60D probably damaging Het
Btbd9 A G 17: 30,527,571 Y94H probably damaging Het
Chil3 A G 3: 106,155,701 I191T probably damaging Het
Clpb T C 7: 101,787,722 L668P probably damaging Het
Dhrs7 A T 12: 72,653,125 N244K probably damaging Het
Dusp4 C T 8: 34,807,736 T3M possibly damaging Het
Edc4 GGATTTTAGCCA G 8: 105,885,068 probably null Het
Etl4 G A 2: 20,806,865 S1621N possibly damaging Het
Fam174a T C 1: 95,313,976 S54P probably benign Het
Fdxacb1 T C 9: 50,770,247 F7S probably damaging Het
Focad G A 4: 88,359,905 probably null Het
Gpr156 T A 16: 37,992,106 L268H probably damaging Het
Gpr17 A T 18: 31,947,251 I253N possibly damaging Het
H2-T23 A T 17: 36,032,166 N106K probably damaging Het
Hspa4 T C 11: 53,280,469 R303G probably damaging Het
Irgm1 G A 11: 48,866,128 silent Het
Jph1 A C 1: 16,997,546 I114S probably damaging Het
Kcna1 C T 6: 126,642,275 D361N possibly damaging Het
Kcna4 G A 2: 107,296,091 R390Q probably damaging Het
Lum C A 10: 97,568,438 P65H probably damaging Het
Mc4r A G 18: 66,859,640 L134P probably benign Het
Mroh8 A T 2: 157,258,040 I248N probably damaging Het
Nos2 A G 11: 78,950,095 T677A probably benign Het
Nup37 T A 10: 88,174,929 F257I possibly damaging Het
Olfr231 C T 1: 174,117,204 V271I probably benign Het
Olfr273 T C 4: 52,855,764 I250V probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pdzd2 A C 15: 12,419,481 M501R possibly damaging Het
Pitx1 T C 13: 55,828,652 K65E probably benign Het
Pla1a C T 16: 38,409,610 A247T probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Prss8 A G 7: 127,929,807 S26P probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rock2 T A 12: 16,977,683 C1334S probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Serpina6 A G 12: 103,646,887 W385R probably damaging Het
Slc12a5 T C 2: 164,979,343 M249T probably benign Het
Srsf9 T A 5: 115,332,592 I117N probably damaging Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc21a T C 9: 119,941,280 V139A probably benign Het
Zfp236 A T 18: 82,630,000 V1012D probably damaging Het
Zfp612 C A 8: 110,089,297 Q379K probably damaging Het
Zfp930 C T 8: 69,228,246 Q198* probably null Het
Other mutations in Cyp2d22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Cyp2d22 APN 15 82371668 missense probably damaging 1.00
IGL01750:Cyp2d22 APN 15 82374369 missense probably benign 0.12
IGL01801:Cyp2d22 APN 15 82372845 missense probably benign 0.41
IGL02449:Cyp2d22 APN 15 82373241 missense probably benign 0.00
ANU22:Cyp2d22 UTSW 15 82371668 missense probably damaging 1.00
R0165:Cyp2d22 UTSW 15 82373280 missense probably benign 0.06
R0294:Cyp2d22 UTSW 15 82374445 missense possibly damaging 0.86
R1381:Cyp2d22 UTSW 15 82372508 missense probably benign 0.00
R1479:Cyp2d22 UTSW 15 82371936 missense probably damaging 0.97
R1562:Cyp2d22 UTSW 15 82373978 missense probably damaging 0.99
R1968:Cyp2d22 UTSW 15 82373172 missense probably benign 0.04
R1972:Cyp2d22 UTSW 15 82375827 missense probably benign 0.11
R4575:Cyp2d22 UTSW 15 82371932 missense possibly damaging 0.94
R4702:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R4703:Cyp2d22 UTSW 15 82375917 missense probably damaging 1.00
R5344:Cyp2d22 UTSW 15 82371638 missense possibly damaging 0.95
R5523:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
R5888:Cyp2d22 UTSW 15 82373813 missense probably benign
R6060:Cyp2d22 UTSW 15 82375885 missense probably benign 0.00
R6108:Cyp2d22 UTSW 15 82371905 missense possibly damaging 0.59
R6146:Cyp2d22 UTSW 15 82373835 critical splice acceptor site probably null
R6279:Cyp2d22 UTSW 15 82373968 missense probably damaging 1.00
R6563:Cyp2d22 UTSW 15 82371912 missense probably damaging 1.00
R7597:Cyp2d22 UTSW 15 82375852 missense probably damaging 1.00
R7709:Cyp2d22 UTSW 15 82374411 missense possibly damaging 0.88
R7839:Cyp2d22 UTSW 15 82372571 missense probably damaging 1.00
R8094:Cyp2d22 UTSW 15 82374355 missense probably benign 0.19
R8302:Cyp2d22 UTSW 15 82371820 critical splice donor site probably null
R8515:Cyp2d22 UTSW 15 82373912 missense probably benign 0.27
R9245:Cyp2d22 UTSW 15 82372547 missense probably damaging 0.97
R9323:Cyp2d22 UTSW 15 82374006 missense probably damaging 1.00
R9521:Cyp2d22 UTSW 15 82372487 missense probably damaging 1.00
Z1186:Cyp2d22 UTSW 15 82375885 missense probably benign 0.00
Z1190:Cyp2d22 UTSW 15 82375885 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCATCACTACTGTAAGATCC -3'
(R):5'- TGCCAAGTCCTATCCGGTAC -3'

Sequencing Primer
(F):5'- ATCACTACTGTAAGATCCTCTGTC -3'
(R):5'- AGTCCTATCCGGTACAGCTAAGTG -3'
Posted On 2015-07-21