Incidental Mutation 'R4493:Tprn'
ID330815
Institutional Source Beutler Lab
Gene Symbol Tprn
Ensembl Gene ENSMUSG00000048707
Gene Nametaperin
Synonyms
MMRRC Submission 041748-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4493 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25262618-25269885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25268892 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 643 (S643P)
Ref Sequence ENSEMBL: ENSMUSP00000109975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028341] [ENSMUST00000028342] [ENSMUST00000114336] [ENSMUST00000129300]
Predicted Effect probably benign
Transcript: ENSMUST00000028341
SMART Domains Protein: ENSMUSP00000028341
Gene: ENSMUSG00000026965

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 123 133 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
low complexity region 456 467 N/A INTRINSIC
CULLIN 515 663 6.72e-9 SMART
APC2 772 832 3.67e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028342
SMART Domains Protein: ENSMUSP00000028342
Gene: ENSMUSG00000026966

DomainStartEndE-ValueType
coiled coil region 13 70 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114336
AA Change: S643P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109975
Gene: ENSMUSG00000048707
AA Change: S643P

DomainStartEndE-ValueType
Pfam:Phostensin_N 8 89 8.3e-38 PFAM
low complexity region 105 117 N/A INTRINSIC
internal_repeat_1 149 273 1.71e-5 PROSPERO
low complexity region 290 322 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
Pfam:Phostensin 506 645 1.8e-65 PFAM
low complexity region 647 665 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129265
Predicted Effect probably benign
Transcript: ENSMUST00000129300
SMART Domains Protein: ENSMUSP00000115177
Gene: ENSMUSG00000026965

DomainStartEndE-ValueType
low complexity region 170 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155738
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sensory epithelial protein. It was defined by linkage analysis in three Pakistani families to lie between D9S1818 (centromeric) and D9SH6 (telomeric). Mutations at this locus have been associated with autosomal recessive deafness. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss and degeneration of hair cell stereocilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc146 T C 5: 21,303,193 E619G possibly damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cngb3 C A 4: 19,367,778 P229Q probably damaging Het
Ctnna2 A G 6: 76,981,848 V461A probably damaging Het
D430041D05Rik T C 2: 104,256,339 D764G probably benign Het
Dgki T C 6: 36,974,861 probably benign Het
Dhx36 A T 3: 62,488,504 probably benign Het
Gcn1l1 T C 5: 115,594,144 I1006T probably benign Het
Glt8d2 T A 10: 82,664,713 M20L possibly damaging Het
Greb1 C A 12: 16,698,610 G1122V probably benign Het
Hmcn1 A T 1: 150,701,899 I2037N probably damaging Het
Hspa4l A G 3: 40,768,002 I340V possibly damaging Het
Itpr3 A G 17: 27,104,612 K1204E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Maats1 T C 16: 38,341,768 T4A probably benign Het
Mcph1 T A 8: 18,631,736 C296* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Naga A G 15: 82,332,514 F259S probably damaging Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Pcdha4 A T 18: 36,954,591 Y609F possibly damaging Het
Pgam1 C T 19: 41,915,776 A104V possibly damaging Het
Piezo2 T C 18: 63,114,063 I525V probably damaging Het
Pold1 A G 7: 44,537,708 V683A probably damaging Het
Poteg T C 8: 27,480,097 V316A possibly damaging Het
Ppih A T 4: 119,310,845 N156K probably damaging Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rtp4 A T 16: 23,610,077 H30L probably benign Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Trrap T C 5: 144,831,048 V2605A probably benign Het
Vmn1r230 T A 17: 20,846,601 N17K probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp946 T A 17: 22,451,086 probably null Het
Other mutations in Tprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03072:Tprn APN 2 25264518 missense probably damaging 1.00
IGL03139:Tprn APN 2 25264054 missense probably benign 0.31
R0568:Tprn UTSW 2 25264321 missense probably damaging 1.00
R0615:Tprn UTSW 2 25264198 missense probably damaging 0.97
R0706:Tprn UTSW 2 25264491 missense probably damaging 1.00
R1675:Tprn UTSW 2 25264409 missense probably benign 0.01
R2508:Tprn UTSW 2 25268928 missense possibly damaging 0.95
R4257:Tprn UTSW 2 25264482 missense probably damaging 1.00
R4494:Tprn UTSW 2 25268892 missense probably damaging 1.00
R4898:Tprn UTSW 2 25268833 missense probably damaging 0.99
R5536:Tprn UTSW 2 25263357 missense probably benign 0.07
R5537:Tprn UTSW 2 25263357 missense probably benign 0.07
R6753:Tprn UTSW 2 25264038 missense probably benign
R7554:Tprn UTSW 2 25263799 missense probably damaging 1.00
X0003:Tprn UTSW 2 25268911 unclassified probably benign
X0010:Tprn UTSW 2 25268911 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCAGCTACAGGTATAGGGTG -3'
(R):5'- GATACCTGCAAGTGTGGTCC -3'

Sequencing Primer
(F):5'- CTACAGGTATAGGGTGGGATAGGTG -3'
(R):5'- TGCAAGTGTGGTCCACATC -3'
Posted On2015-07-21