Incidental Mutation 'R4493:Hspa4l'
ID 330819
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 041748-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R4493 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40722434 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 340 (I340V)
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably benign
Transcript: ENSMUST00000108086
AA Change: I319V

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: I319V

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203353
AA Change: I340V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757
AA Change: I340V

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect possibly damaging
Transcript: ENSMUST00000204702
AA Change: I340V

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: I340V

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Meta Mutation Damage Score 0.1999 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1b T C 2: 24,542,950 (GRCm39) T1301A probably damaging Het
Ccdc141 A G 2: 76,962,641 (GRCm39) V101A probably damaging Het
Ccdc146 T C 5: 21,508,191 (GRCm39) E619G possibly damaging Het
Cfap91 T C 16: 38,162,130 (GRCm39) T4A probably benign Het
Cmya5 T C 13: 93,230,573 (GRCm39) E1505G probably benign Het
Cngb3 C A 4: 19,367,778 (GRCm39) P229Q probably damaging Het
Ctnna2 A G 6: 76,958,831 (GRCm39) V461A probably damaging Het
D430041D05Rik T C 2: 104,086,684 (GRCm39) D764G probably benign Het
Dgki T C 6: 36,951,796 (GRCm39) probably benign Het
Dhx36 A T 3: 62,395,925 (GRCm39) probably benign Het
Gcn1 T C 5: 115,732,203 (GRCm39) I1006T probably benign Het
Glt8d2 T A 10: 82,500,547 (GRCm39) M20L possibly damaging Het
Greb1 C A 12: 16,748,611 (GRCm39) G1122V probably benign Het
Hmcn1 A T 1: 150,577,650 (GRCm39) I2037N probably damaging Het
Itpr3 A G 17: 27,323,586 (GRCm39) K1204E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Lyst G A 13: 13,809,968 (GRCm39) R546H probably damaging Het
Mcph1 T A 8: 18,681,752 (GRCm39) C296* probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Naga A G 15: 82,216,715 (GRCm39) F259S probably damaging Het
Nes A G 3: 87,884,120 (GRCm39) E793G probably damaging Het
Nfkb2 A G 19: 46,296,878 (GRCm39) D316G probably damaging Het
Pcdha4 A T 18: 37,087,644 (GRCm39) Y609F possibly damaging Het
Pgam1 C T 19: 41,904,215 (GRCm39) A104V possibly damaging Het
Piezo2 T C 18: 63,247,134 (GRCm39) I525V probably damaging Het
Pold1 A G 7: 44,187,132 (GRCm39) V683A probably damaging Het
Poteg T C 8: 27,970,125 (GRCm39) V316A possibly damaging Het
Ppih A T 4: 119,168,042 (GRCm39) N156K probably damaging Het
Prep T C 10: 44,996,915 (GRCm39) F398L probably benign Het
Prlhr A T 19: 60,455,519 (GRCm39) M349K probably benign Het
Rtp4 A T 16: 23,428,827 (GRCm39) H30L probably benign Het
Stkld1 A G 2: 26,836,638 (GRCm39) N268S probably benign Het
Syt6 A G 3: 103,492,946 (GRCm39) E66G probably damaging Het
Tas2r129 A G 6: 132,928,317 (GRCm39) I85V probably benign Het
Tma16 C T 8: 66,936,823 (GRCm39) probably null Het
Tprn T C 2: 25,158,904 (GRCm39) S643P probably damaging Het
Trrap T C 5: 144,767,858 (GRCm39) V2605A probably benign Het
Vmn1r230 T A 17: 21,066,863 (GRCm39) N17K probably benign Het
Xkrx T C X: 133,051,745 (GRCm39) N302S possibly damaging Het
Zfp946 T A 17: 22,670,067 (GRCm39) probably null Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGTCACTGCCATCTGGAC -3'
(R):5'- AGACAGACAGACTTGCCAAG -3'

Sequencing Primer
(F):5'- CCATCTGGACCACACTCAGTG -3'
(R):5'- GATAACAGCTTCTTCAGAGTTGTCAC -3'
Posted On 2015-07-21