Incidental Mutation 'R4493:Ccdc146'
ID330824
Institutional Source Beutler Lab
Gene Symbol Ccdc146
Ensembl Gene ENSMUSG00000064280
Gene Namecoiled-coil domain containing 146
Synonyms4930528G09Rik
MMRRC Submission 041748-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4493 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21292961-21424677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21303193 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 619 (E619G)
Ref Sequence ENSEMBL: ENSMUSP00000110900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115245] [ENSMUST00000198930]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115245
AA Change: E619G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280
AA Change: E619G

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199553
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 94% (45/48)
MGI Phenotype Homozygous null mice for one allele have unaltered type 1 immunity responses. Homozygous null mice for another allele show partial embryonic lethality, hemorrhage at implantation sites, decreased susceptibility to hepatitis virus infection and prolonged survival of heart grafts.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cngb3 C A 4: 19,367,778 P229Q probably damaging Het
Ctnna2 A G 6: 76,981,848 V461A probably damaging Het
D430041D05Rik T C 2: 104,256,339 D764G probably benign Het
Dgki T C 6: 36,974,861 probably benign Het
Dhx36 A T 3: 62,488,504 probably benign Het
Gcn1l1 T C 5: 115,594,144 I1006T probably benign Het
Glt8d2 T A 10: 82,664,713 M20L possibly damaging Het
Greb1 C A 12: 16,698,610 G1122V probably benign Het
Hmcn1 A T 1: 150,701,899 I2037N probably damaging Het
Hspa4l A G 3: 40,768,002 I340V possibly damaging Het
Itpr3 A G 17: 27,104,612 K1204E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Maats1 T C 16: 38,341,768 T4A probably benign Het
Mcph1 T A 8: 18,631,736 C296* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Naga A G 15: 82,332,514 F259S probably damaging Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Pcdha4 A T 18: 36,954,591 Y609F possibly damaging Het
Pgam1 C T 19: 41,915,776 A104V possibly damaging Het
Piezo2 T C 18: 63,114,063 I525V probably damaging Het
Pold1 A G 7: 44,537,708 V683A probably damaging Het
Poteg T C 8: 27,480,097 V316A possibly damaging Het
Ppih A T 4: 119,310,845 N156K probably damaging Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rtp4 A T 16: 23,610,077 H30L probably benign Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Trrap T C 5: 144,831,048 V2605A probably benign Het
Vmn1r230 T A 17: 20,846,601 N17K probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp946 T A 17: 22,451,086 probably null Het
Other mutations in Ccdc146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc146 APN 5 21301422 missense possibly damaging 0.93
IGL01066:Ccdc146 APN 5 21319542 missense probably benign 0.03
IGL01399:Ccdc146 APN 5 21294613 missense possibly damaging 0.75
IGL01866:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01868:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01869:Ccdc146 APN 5 21316839 missense probably benign 0.25
IGL02213:Ccdc146 APN 5 21316904 missense probably benign 0.10
IGL02338:Ccdc146 APN 5 21319606 unclassified probably benign
IGL02553:Ccdc146 APN 5 21297633 missense probably benign 0.00
IGL02838:Ccdc146 APN 5 21297569 missense probably benign 0.01
Starcraft UTSW 5 21399614 splice site probably null
R0051:Ccdc146 UTSW 5 21316904 missense possibly damaging 0.58
R0051:Ccdc146 UTSW 5 21316904 missense possibly damaging 0.58
R0055:Ccdc146 UTSW 5 21297006 synonymous probably null
R0115:Ccdc146 UTSW 5 21322756 missense possibly damaging 0.87
R0373:Ccdc146 UTSW 5 21319545 missense probably benign 0.00
R1251:Ccdc146 UTSW 5 21293372 missense probably benign 0.00
R1355:Ccdc146 UTSW 5 21321242 missense probably damaging 1.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1556:Ccdc146 UTSW 5 21330553 missense probably damaging 1.00
R1613:Ccdc146 UTSW 5 21294524 missense probably damaging 0.99
R1872:Ccdc146 UTSW 5 21301290 missense probably benign 0.01
R2271:Ccdc146 UTSW 5 21399721 missense probably benign 0.15
R2329:Ccdc146 UTSW 5 21308612 critical splice donor site probably null
R2518:Ccdc146 UTSW 5 21305528 missense probably benign
R2680:Ccdc146 UTSW 5 21305269 missense possibly damaging 0.58
R3116:Ccdc146 UTSW 5 21316955 missense probably benign 0.02
R3121:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3122:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3159:Ccdc146 UTSW 5 21399792 missense unknown
R3436:Ccdc146 UTSW 5 21297005 missense possibly damaging 0.92
R4043:Ccdc146 UTSW 5 21316943 missense probably benign 0.14
R4226:Ccdc146 UTSW 5 21322758 missense probably benign 0.09
R5013:Ccdc146 UTSW 5 21333038 missense probably damaging 1.00
R5024:Ccdc146 UTSW 5 21399614 splice site probably null
R5051:Ccdc146 UTSW 5 21303083 missense possibly damaging 0.77
R5384:Ccdc146 UTSW 5 21308713 missense probably benign 0.37
R5532:Ccdc146 UTSW 5 21305331 missense probably benign 0.02
R5906:Ccdc146 UTSW 5 21301352 missense possibly damaging 0.88
R5927:Ccdc146 UTSW 5 21308621 nonsense probably null
R5951:Ccdc146 UTSW 5 21319579 missense possibly damaging 0.84
R5978:Ccdc146 UTSW 5 21316968 missense probably benign 0.02
R5990:Ccdc146 UTSW 5 21318182 missense probably benign 0.41
R6123:Ccdc146 UTSW 5 21305597 missense possibly damaging 0.93
R6217:Ccdc146 UTSW 5 21317902 intron probably null
R6276:Ccdc146 UTSW 5 21301340 missense probably damaging 0.98
R6665:Ccdc146 UTSW 5 21303094 missense probably damaging 1.00
R7077:Ccdc146 UTSW 5 21305274 missense possibly damaging 0.94
R7204:Ccdc146 UTSW 5 21308626 missense probably benign 0.22
R7336:Ccdc146 UTSW 5 21303112 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACATGGCTACCTCTCAGTAGG -3'
(R):5'- ATCCCACAACAGAGAAAGTGTG -3'

Sequencing Primer
(F):5'- TACCTCTCAGTAGGGTCCCG -3'
(R):5'- CCACAACAGAGAAAGTGTGTCCTG -3'
Posted On2015-07-21