Incidental Mutation 'R0069:Lzts3'
ID33083
Institutional Source Beutler Lab
Gene Symbol Lzts3
Ensembl Gene ENSMUSG00000037703
Gene Nameleucine zipper, putative tumor suppressor family member 3
SynonymsProsapip1
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location130632839-130642803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130636540 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 213 (T213S)
Ref Sequence ENSEMBL: ENSMUSP00000086990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045761] [ENSMUST00000089561] [ENSMUST00000110260]
Predicted Effect probably benign
Transcript: ENSMUST00000045761
AA Change: T213S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037109
Gene: ENSMUSG00000037703
AA Change: T213S

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 665 1.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089561
AA Change: T213S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000086990
Gene: ENSMUSG00000037703
AA Change: T213S

DomainStartEndE-ValueType
low complexity region 86 107 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 301 333 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
low complexity region 349 361 N/A INTRINSIC
low complexity region 402 436 N/A INTRINSIC
Pfam:Fez1 465 666 2.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110260
AA Change: T99S

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105889
Gene: ENSMUSG00000037703
AA Change: T99S

DomainStartEndE-ValueType
low complexity region 126 136 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 171 183 N/A INTRINSIC
low complexity region 187 219 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
low complexity region 288 322 N/A INTRINSIC
Pfam:Fez1 351 552 1.5e-74 PFAM
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Lzts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Lzts3 APN 2 130635445 missense probably damaging 0.99
IGL01541:Lzts3 APN 2 130636206 missense probably damaging 0.99
IGL01649:Lzts3 APN 2 130635431 missense probably damaging 0.98
IGL02746:Lzts3 APN 2 130636341 missense probably damaging 0.98
IGL02927:Lzts3 APN 2 130637957 utr 5 prime probably benign
R0069:Lzts3 UTSW 2 130636540 missense probably benign 0.16
R0173:Lzts3 UTSW 2 130634768 makesense probably null
R1381:Lzts3 UTSW 2 130635299 missense probably damaging 0.99
R4127:Lzts3 UTSW 2 130635365 missense probably damaging 0.99
R4301:Lzts3 UTSW 2 130636438 missense probably damaging 0.99
R4588:Lzts3 UTSW 2 130634766 makesense probably null
R5289:Lzts3 UTSW 2 130636101 missense probably benign 0.18
R5878:Lzts3 UTSW 2 130636539 missense probably damaging 1.00
R5964:Lzts3 UTSW 2 130636288 missense probably damaging 0.99
R6193:Lzts3 UTSW 2 130637386 missense probably damaging 0.97
R7692:Lzts3 UTSW 2 130635386 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ACTATAGCCAGCGGTGCCAATACG -3'
(R):5'- GCAGGAGGTGGTTCTTGAACAAGTC -3'

Sequencing Primer
(F):5'- CGGTGCCAATACGGTTGATATG -3'
(R):5'- CTTGAACAAGTCTTGGGCG -3'
Posted On2013-05-09