Mutagenetix > Incidental Mutations

Incidental Mutation 'R4493:Lyst'

330842

Institutional Source

Beutler Lab

Gene Symbol

Lyst

Ensembl Gene

ENSMUSG00000019726

Gene Name

lysosomal trafficking regulator

Synonyms

D13Sfk13

MMRRC Submission

041748-MU

Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Is this an essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R4493 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13590397-13778803 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 13635383 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 546 (R546H)

Ref Sequence

ENSEMBL: ENSMUSP00000106188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110559]

Predicted Effect

probably damaging
Transcript: ENSMUST00000110559
AA Change: R546H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: R546H

Domain	Start	End	E-Value	Type
low complexity region	26	36	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	2295	2307	N/A	INTRINSIC
low complexity region	2427	2445	N/A	INTRINSIC
low complexity region	2534	2546	N/A	INTRINSIC
Pfam:PH_BEACH	3006	3101	5.8e-25	PFAM
Beach	3118	3408	1.25e-193	SMART
Blast:Beach	3441	3478	9e-13	BLAST
WD40	3539	3579	5.75e-1	SMART
WD40	3591	3630	2.89e-5	SMART
WD40	3633	3676	1.38e0	SMART
WD40	3724	3765	1.27e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220937

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223053

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223527

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

94% (45/48)

MGI Phenotype

Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]

Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cacna1b	T	C	2: 24,652,938	T1301A	probably damaging	Het
Ccdc141	A	G	2: 77,132,297	V101A	probably damaging	Het
Ccdc146	T	C	5: 21,303,193	E619G	possibly damaging	Het
Cmya5	T	C	13: 93,094,065	E1505G	probably benign	Het
Cngb3	C	A	4: 19,367,778	P229Q	probably damaging	Het
Ctnna2	A	G	6: 76,981,848	V461A	probably damaging	Het
D430041D05Rik	T	C	2: 104,256,339	D764G	probably benign	Het
Dgki	T	C	6: 36,974,861		probably benign	Het
Dhx36	A	T	3: 62,488,504		probably benign	Het
Gcn1l1	T	C	5: 115,594,144	I1006T	probably benign	Het
Glt8d2	T	A	10: 82,664,713	M20L	possibly damaging	Het
Greb1	C	A	12: 16,698,610	G1122V	probably benign	Het
Hmcn1	A	T	1: 150,701,899	I2037N	probably damaging	Het
Hspa4l	A	G	3: 40,768,002	I340V	possibly damaging	Het
Itpr3	A	G	17: 27,104,612	K1204E	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Maats1	T	C	16: 38,341,768	T4A	probably benign	Het
Mcph1	T	A	8: 18,631,736	C296*	probably null	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naga	A	G	15: 82,332,514	F259S	probably damaging	Het
Nes	A	G	3: 87,976,813	E793G	probably damaging	Het
Nfkb2	A	G	19: 46,308,439	D316G	probably damaging	Het
Pcdha4	A	T	18: 36,954,591	Y609F	possibly damaging	Het
Pgam1	C	T	19: 41,915,776	A104V	possibly damaging	Het
Piezo2	T	C	18: 63,114,063	I525V	probably damaging	Het
Pold1	A	G	7: 44,537,708	V683A	probably damaging	Het
Poteg	T	C	8: 27,480,097	V316A	possibly damaging	Het
Ppih	A	T	4: 119,310,845	N156K	probably damaging	Het
Prep	T	C	10: 45,120,819	F398L	probably benign	Het
Prlhr	A	T	19: 60,467,081	M349K	probably benign	Het
Rtp4	A	T	16: 23,610,077	H30L	probably benign	Het
Stkld1	A	G	2: 26,946,626	N268S	probably benign	Het
Syt6	A	G	3: 103,585,630	E66G	probably damaging	Het
Tas2r129	A	G	6: 132,951,354	I85V	probably benign	Het
Tma16	C	T	8: 66,484,171		probably null	Het
Tprn	T	C	2: 25,268,892	S643P	probably damaging	Het
Trrap	T	C	5: 144,831,048	V2605A	probably benign	Het
Vmn1r230	T	A	17: 20,846,601	N17K	probably benign	Het
Xkrx	T	C	X: 134,150,996	N302S	possibly damaging	Het
Zfp946	T	A	17: 22,451,086		probably null	Het

Other mutations in Lyst

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Lyst	APN	13	13648878	missense	probably benign
IGL00474:Lyst	APN	13	13643536	missense	possibly damaging	0.48
IGL00484:Lyst	APN	13	13709603	missense	probably benign	0.02
IGL00492:Lyst	APN	13	13678175	missense	possibly damaging	0.54
IGL00807:Lyst	APN	13	13650423	missense	possibly damaging	0.91
IGL00949:Lyst	APN	13	13635485	missense	possibly damaging	0.87
IGL00952:Lyst	APN	13	13678107	missense	probably benign	0.05
IGL01305:Lyst	APN	13	13678056	missense	probably benign	0.01
IGL01317:Lyst	APN	13	13670870	missense	probably benign
IGL01419:Lyst	APN	13	13635838	missense	probably benign	0.00
IGL01445:Lyst	APN	13	13651714	missense	probably benign	0.00
IGL01690:Lyst	APN	13	13743246	missense	probably damaging	1.00
IGL01791:Lyst	APN	13	13635302	missense	probably damaging	1.00
IGL01809:Lyst	APN	13	13637803	missense	probably damaging	1.00
IGL01896:Lyst	APN	13	13635577	missense	probably benign	0.04
IGL01938:Lyst	APN	13	13637424	missense	possibly damaging	0.93
IGL01986:Lyst	APN	13	13775627	critical splice donor site	probably null
IGL02022:Lyst	APN	13	13664044	nonsense	probably null
IGL02044:Lyst	APN	13	13712846	missense	probably damaging	1.00
IGL02157:Lyst	APN	13	13660956	missense	probably benign
IGL02185:Lyst	APN	13	13661093	nonsense	probably null
IGL02215:Lyst	APN	13	13660956	missense	probably benign
IGL02245:Lyst	APN	13	13660956	missense	probably benign
IGL02246:Lyst	APN	13	13660956	missense	probably benign
IGL02247:Lyst	APN	13	13660956	missense	probably benign
IGL02297:Lyst	APN	13	13638092	nonsense	probably null
IGL02411:Lyst	APN	13	13660956	missense	probably benign
IGL02415:Lyst	APN	13	13660956	missense	probably benign
IGL02419:Lyst	APN	13	13660956	missense	probably benign
IGL02420:Lyst	APN	13	13660956	missense	probably benign
IGL02429:Lyst	APN	13	13660956	missense	probably benign
IGL02501:Lyst	APN	13	13711645	missense	probably benign	0.02
IGL02522:Lyst	APN	13	13634705	missense	possibly damaging	0.81
IGL02535:Lyst	APN	13	13650342	missense	probably benign	0.00
IGL02596:Lyst	APN	13	13660956	missense	probably benign
IGL02601:Lyst	APN	13	13660956	missense	probably benign
IGL02603:Lyst	APN	13	13660956	missense	probably benign
IGL02608:Lyst	APN	13	13712754	missense	probably damaging	0.98
IGL02622:Lyst	APN	13	13681390	missense	probably damaging	1.00
IGL02690:Lyst	APN	13	13641125	missense	possibly damaging	0.58
IGL02715:Lyst	APN	13	13674320	splice site	probably null
IGL02725:Lyst	APN	13	13760827	missense	probably damaging	1.00
IGL02729:Lyst	APN	13	13674339	missense	possibly damaging	0.81
IGL02729:Lyst	APN	13	13746609	missense	possibly damaging	0.95
IGL02820:Lyst	APN	13	13638058	missense	probably benign	0.03
IGL02945:Lyst	APN	13	13761198	missense	possibly damaging	0.48
IGL02981:Lyst	APN	13	13634911	missense	probably damaging	0.99
IGL03087:Lyst	APN	13	13635056	missense	probably damaging	1.00
IGL03149:Lyst	APN	13	13681444	missense	probably benign	0.14
IGL03158:Lyst	APN	13	13651752	critical splice donor site	probably null
IGL03226:Lyst	APN	13	13709559	missense	probably benign	0.01
IGL03242:Lyst	APN	13	13656881	nonsense	probably null
IGL03385:Lyst	APN	13	13656980	nonsense	probably null
50-cal	UTSW	13	13708212	critical splice donor site	probably null
charcoal	UTSW	13	13696761	nonsense	probably null
charlotte_gray	UTSW	13	13602026	intron	probably benign
charzard	UTSW	13	13647083	nonsense	probably null
grey_wolf	UTSW	13		unclassified
lightspeed	UTSW	13	13740536	missense	possibly damaging	0.91
pardon	UTSW	13	13677952	missense	probably benign	0.00
robin	UTSW	13	13648802	nonsense	probably null
sooty	UTSW	13		unclassified
souris	UTSW	13	13683224	unclassified	probably benign
Swallow	UTSW	13	13757422	missense	probably benign	0.00
vulpix	UTSW	13	13696794	splice site	probably null
ANU22:Lyst	UTSW	13	13678056	missense	probably benign	0.01
IGL02835:Lyst	UTSW	13	13661100	missense	possibly damaging	0.82
P0031:Lyst	UTSW	13	13664031	missense	probably damaging	1.00
R0012:Lyst	UTSW	13	13687694	missense	probably benign	0.10
R0012:Lyst	UTSW	13	13687694	missense	probably benign	0.10
R0031:Lyst	UTSW	13	13708156	missense	probably benign	0.14
R0115:Lyst	UTSW	13	13677952	missense	probably benign	0.00
R0212:Lyst	UTSW	13	13635985	missense	possibly damaging	0.93
R0386:Lyst	UTSW	13	13708214	splice site	probably benign
R0393:Lyst	UTSW	13	13647079	missense	probably benign	0.01
R0415:Lyst	UTSW	13	13711610	splice site	probably benign
R0446:Lyst	UTSW	13	13638048	missense	probably benign	0.00
R0481:Lyst	UTSW	13	13677952	missense	probably benign	0.00
R0499:Lyst	UTSW	13	13616713	missense	probably damaging	1.00
R0506:Lyst	UTSW	13	13638015	missense	probably benign
R0530:Lyst	UTSW	13	13757306	splice site	probably benign
R0541:Lyst	UTSW	13	13681293	missense	probably benign	0.00
R0570:Lyst	UTSW	13	13709386	missense	probably benign	0.26
R0680:Lyst	UTSW	13	13650341	missense	probably benign	0.01
R0842:Lyst	UTSW	13	13678241	nonsense	probably null
R0848:Lyst	UTSW	13	13634930	missense	probably benign	0.00
R1014:Lyst	UTSW	13	13634060	missense	possibly damaging	0.49
R1205:Lyst	UTSW	13	13680202	missense	probably benign
R1251:Lyst	UTSW	13	13634483	missense	probably benign	0.00
R1304:Lyst	UTSW	13	13751984	nonsense	probably null
R1398:Lyst	UTSW	13	13740536	missense	possibly damaging	0.91
R1445:Lyst	UTSW	13	13640054	missense	possibly damaging	0.94
R1475:Lyst	UTSW	13	13708212	critical splice donor site	probably null
R1479:Lyst	UTSW	13	13634482	missense	probably benign	0.00
R1484:Lyst	UTSW	13	13678190	missense	probably benign	0.01
R1498:Lyst	UTSW	13	13650375	missense	possibly damaging	0.49
R1540:Lyst	UTSW	13	13635101	missense	possibly damaging	0.81
R1611:Lyst	UTSW	13	13634897	missense	probably damaging	0.97
R1653:Lyst	UTSW	13	13635226	missense	probably damaging	1.00
R1669:Lyst	UTSW	13	13644087	missense	possibly damaging	0.90
R1686:Lyst	UTSW	13	13634705	missense	possibly damaging	0.81
R1694:Lyst	UTSW	13	13661161	missense	probably damaging	0.98
R1747:Lyst	UTSW	13	13757422	missense	probably benign	0.00
R1793:Lyst	UTSW	13	13647083	nonsense	probably null
R1871:Lyst	UTSW	13	13651712	missense	probably benign	0.00
R1905:Lyst	UTSW	13	13634134	missense	probably benign
R1958:Lyst	UTSW	13	13616618	missense	probably damaging	1.00
R1969:Lyst	UTSW	13	13730344	missense	probably damaging	0.99
R2040:Lyst	UTSW	13	13641222	missense	probably benign	0.00
R2109:Lyst	UTSW	13	13712820	missense	possibly damaging	0.46
R2116:Lyst	UTSW	13	13635701	missense	probably damaging	0.99
R2121:Lyst	UTSW	13	13660971	missense	probably damaging	1.00
R2127:Lyst	UTSW	13	13635262	missense	probably damaging	1.00
R2187:Lyst	UTSW	13	13709341	missense	possibly damaging	0.61
R2238:Lyst	UTSW	13	13743263	missense	probably benign	0.41
R2258:Lyst	UTSW	13	13637658	missense	probably benign	0.00
R2292:Lyst	UTSW	13	13740495	missense	probably damaging	1.00
R2368:Lyst	UTSW	13	13696663	missense	probably damaging	0.96
R2908:Lyst	UTSW	13	13669873	missense	probably benign	0.03
R3001:Lyst	UTSW	13	13696705	missense	probably benign
R3002:Lyst	UTSW	13	13696705	missense	probably benign
R3024:Lyst	UTSW	13	13658687	missense	probably benign
R3113:Lyst	UTSW	13	13669927	missense	probably benign	0.12
R3406:Lyst	UTSW	13	13635230	missense	possibly damaging	0.56
R3972:Lyst	UTSW	13	13706625	missense	possibly damaging	0.67
R3978:Lyst	UTSW	13	13634168	missense	possibly damaging	0.82
R4032:Lyst	UTSW	13	13616665	missense	probably damaging	1.00
R4192:Lyst	UTSW	13	13740513	missense	probably damaging	1.00
R4206:Lyst	UTSW	13	13635989	missense	probably benign	0.03
R4298:Lyst	UTSW	13	13634887	missense	probably damaging	1.00
R4344:Lyst	UTSW	13	13698466	missense	probably benign	0.06
R4441:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4445:Lyst	UTSW	13	13709564	missense	probably benign	0.42
R4477:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4494:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4495:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4622:Lyst	UTSW	13	13674398	missense	probably benign	0.01
R4638:Lyst	UTSW	13	13696794	splice site	probably null
R4658:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4675:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4719:Lyst	UTSW	13	13650350	missense	probably benign
R4729:Lyst	UTSW	13	13637901	missense	probably damaging	1.00
R4774:Lyst	UTSW	13	13740597	missense	probably damaging	1.00
R4811:Lyst	UTSW	13	13777100	missense	probably benign	0.33
R4877:Lyst	UTSW	13	13683149	missense	probably damaging	1.00
R4920:Lyst	UTSW	13	13647060	missense	possibly damaging	0.79
R4933:Lyst	UTSW	13	13637764	missense	probably damaging	0.98
R4933:Lyst	UTSW	13	13759378	missense	probably benign	0.12
R4958:Lyst	UTSW	13	13635463	missense	probably benign	0.00
R4982:Lyst	UTSW	13	13725954	missense	probably damaging	1.00
R4992:Lyst	UTSW	13	13661163	missense	probably damaging	1.00
R5024:Lyst	UTSW	13	13634404	missense	probably benign
R5049:Lyst	UTSW	13	13636064	missense	probably damaging	1.00
R5079:Lyst	UTSW	13	13757353	missense	probably benign	0.08
R5254:Lyst	UTSW	13	13683070	missense	probably benign	0.00
R5266:Lyst	UTSW	13	13660970	missense	probably damaging	1.00
R5279:Lyst	UTSW	13	13648802	nonsense	probably null
R5285:Lyst	UTSW	13	13634426	missense	probably benign	0.01
R5364:Lyst	UTSW	13	13656854	missense	probably benign	0.35
R5435:Lyst	UTSW	13	13777064	missense	possibly damaging	0.64
R5516:Lyst	UTSW	13	13644122	missense	probably benign	0.10
R5524:Lyst	UTSW	13	13746779	missense	probably benign	0.03
R5591:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5592:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5593:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5594:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5594:Lyst	UTSW	13	13759397	missense	probably benign	0.00
R5644:Lyst	UTSW	13	13637496	missense	possibly damaging	0.58
R5659:Lyst	UTSW	13	13634627	missense	possibly damaging	0.58
R5741:Lyst	UTSW	13	13634030	missense	probably benign	0.44
R5908:Lyst	UTSW	13	13696761	nonsense	probably null
R5969:Lyst	UTSW	13	13687813	splice site	probably null
R6128:Lyst	UTSW	13	13759379	missense	possibly damaging	0.67
R6271:Lyst	UTSW	13	13658754	missense	probably benign	0.30
R6315:Lyst	UTSW	13	13643504	missense	probably benign
R6318:Lyst	UTSW	13	13743311	missense	possibly damaging	0.88
R6555:Lyst	UTSW	13	13648925	missense	probably benign	0.01
R6663:Lyst	UTSW	13	13664116	splice site	probably null
R6701:Lyst	UTSW	13	13681485	missense	probably benign	0.06
R6711:Lyst	UTSW	13	13635235	missense	possibly damaging	0.80
R6909:Lyst	UTSW	13	13743375	missense	probably damaging	1.00
R6915:Lyst	UTSW	13	13726044	missense	probably benign	0.01
R6929:Lyst	UTSW	13	13743324	missense	probably damaging	1.00
R6960:Lyst	UTSW	13	13634078	missense	probably benign	0.12
R7018:Lyst	UTSW	13	13743459	critical splice donor site	probably null
R7037:Lyst	UTSW	13	13616666	missense	probably damaging	1.00
R7045:Lyst	UTSW	13	13634900	missense	probably benign	0.34
R7045:Lyst	UTSW	13	13637708	missense	probably damaging	1.00
R7070:Lyst	UTSW	13	13757444	missense	probably benign	0.23
R7188:Lyst	UTSW	13	13752090	missense	possibly damaging	0.66
R7201:Lyst	UTSW	13	13709300	nonsense	probably null
R7210:Lyst	UTSW	13	13656983	missense	probably damaging	1.00
R7229:Lyst	UTSW	13	13643509	missense	probably benign	0.00
R7293:Lyst	UTSW	13	13680237	missense	probably benign	0.01
R7318:Lyst	UTSW	13	13757443	missense	probably benign	0.13
R7344:Lyst	UTSW	13	13706555	missense	probably benign
R7426:Lyst	UTSW	13	13637524	missense	probably benign
R7522:Lyst	UTSW	13	13647083	nonsense	probably null
R7583:Lyst	UTSW	13	13635887	missense	probably damaging	1.00
R7606:Lyst	UTSW	13	13637475	missense	probably damaging	1.00
R7636:Lyst	UTSW	13	13616747	critical splice donor site	probably null
R7658:Lyst	UTSW	13	13730476	missense	possibly damaging	0.63
R7685:Lyst	UTSW	13	13669865	missense	probably benign	0.00
R7689:Lyst	UTSW	13	13683223	critical splice donor site	probably null
R7765:Lyst	UTSW	13	13709532	missense	possibly damaging	0.75
R7779:Lyst	UTSW	13	13634543	missense	probably damaging	1.00
R7871:Lyst	UTSW	13	13636052	nonsense	probably null
R7872:Lyst	UTSW	13	13635865	missense	probably benign	0.14
R7884:Lyst	UTSW	13	13707683	missense	probably benign	0.09
R7890:Lyst	UTSW	13	13740569	missense	probably damaging	0.99
R7916:Lyst	UTSW	13	13647072	missense	possibly damaging	0.64
R7948:Lyst	UTSW	13	13746589	missense	possibly damaging	0.59
R7956:Lyst	UTSW	13	13641203	missense	possibly damaging	0.80
R8048:Lyst	UTSW	13	13687645	missense	probably benign	0.12
R8085:Lyst	UTSW	13	13634309	missense	probably damaging	0.98
R8165:Lyst	UTSW	13	13698360	missense	probably damaging	0.99
R8235:Lyst	UTSW	13	13760738	missense	possibly damaging	0.69
R8237:Lyst	UTSW	13	13651732	missense	probably benign	0.00
R8275:Lyst	UTSW	13	13776082	missense	probably benign	0.02
R8300:Lyst	UTSW	13	13664058	missense	possibly damaging	0.79
R8350:Lyst	UTSW	13	13650388	nonsense	probably null
R8526:Lyst	UTSW	13	13760806	missense	probably damaging	0.99
R8551:Lyst	UTSW	13	13634060	missense	possibly damaging	0.77
RF001:Lyst	UTSW	13	13635841	missense	probably benign
RF002:Lyst	UTSW	13	13634363	missense	probably benign	0.05
X0024:Lyst	UTSW	13	13634448	missense	probably benign	0.00
X0026:Lyst	UTSW	13	13751970	missense	probably damaging	0.99
Z1088:Lyst	UTSW	13	13743433	missense	probably benign	0.09
Z1176:Lyst	UTSW	13	13640107	missense	probably damaging	1.00
Z1176:Lyst	UTSW	13	13777079	missense	probably benign	0.27
Z1177:Lyst	UTSW	13	13680134	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- CTGCAGAACATTTGAAAGCTCTG -3'
(R):5'- GGAAAGCTTTCAGTGCTGGC -3'

Sequencing Primer
(F):5'- GGTGAAATCAGAGCAACTTCATC -3'
(R):5'- TCAGTGCTGGCAACTTAAAAGC -3'

Posted On

2015-07-21