Incidental Mutation 'R4493:Maats1'
List |< first << previous [record 18 of 41] next >> last >|
ID330846
Institutional Source Beutler Lab
Gene Symbol Maats1
Ensembl Gene ENSMUSG00000022805
Gene NameMYCBP-associated, testis expressed 1
SynonymsSpata26, 4932425I24Rik
MMRRC Submission 041748-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4493 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38297754-38342143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38341768 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 4 (T4A)
Ref Sequence ENSEMBL: ENSMUSP00000110388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023501] [ENSMUST00000114740]
Predicted Effect probably benign
Transcript: ENSMUST00000023501
AA Change: T4A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023501
Gene: ENSMUSG00000022805
AA Change: T4A

DomainStartEndE-ValueType
Pfam:PaaSYMP 190 342 1.4e-65 PFAM
low complexity region 413 428 N/A INTRINSIC
low complexity region 513 526 N/A INTRINSIC
low complexity region 599 613 N/A INTRINSIC
coiled coil region 650 682 N/A INTRINSIC
coiled coil region 737 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114740
AA Change: T4A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110388
Gene: ENSMUSG00000022805
AA Change: T4A

DomainStartEndE-ValueType
Pfam:PaaSYMP 189 342 1.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141896
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc146 T C 5: 21,303,193 E619G possibly damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cngb3 C A 4: 19,367,778 P229Q probably damaging Het
Ctnna2 A G 6: 76,981,848 V461A probably damaging Het
D430041D05Rik T C 2: 104,256,339 D764G probably benign Het
Dgki T C 6: 36,974,861 probably benign Het
Dhx36 A T 3: 62,488,504 probably benign Het
Gcn1l1 T C 5: 115,594,144 I1006T probably benign Het
Glt8d2 T A 10: 82,664,713 M20L possibly damaging Het
Greb1 C A 12: 16,698,610 G1122V probably benign Het
Hmcn1 A T 1: 150,701,899 I2037N probably damaging Het
Hspa4l A G 3: 40,768,002 I340V possibly damaging Het
Itpr3 A G 17: 27,104,612 K1204E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcph1 T A 8: 18,631,736 C296* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Naga A G 15: 82,332,514 F259S probably damaging Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Pcdha4 A T 18: 36,954,591 Y609F possibly damaging Het
Pgam1 C T 19: 41,915,776 A104V possibly damaging Het
Piezo2 T C 18: 63,114,063 I525V probably damaging Het
Pold1 A G 7: 44,537,708 V683A probably damaging Het
Poteg T C 8: 27,480,097 V316A possibly damaging Het
Ppih A T 4: 119,310,845 N156K probably damaging Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rtp4 A T 16: 23,610,077 H30L probably benign Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Trrap T C 5: 144,831,048 V2605A probably benign Het
Vmn1r230 T A 17: 20,846,601 N17K probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp946 T A 17: 22,451,086 probably null Het
Other mutations in Maats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Maats1 APN 16 38336342 critical splice donor site probably null
IGL02243:Maats1 APN 16 38341780 utr 5 prime probably benign
IGL02377:Maats1 APN 16 38332819 splice site probably benign
IGL02604:Maats1 APN 16 38321559 unclassified probably benign
IGL02623:Maats1 APN 16 38333778 missense possibly damaging 0.51
IGL02985:Maats1 APN 16 38298272 missense probably damaging 0.98
IGL03389:Maats1 APN 16 38324136 critical splice donor site probably null
PIT4280001:Maats1 UTSW 16 38332773 missense probably benign 0.23
PIT4449001:Maats1 UTSW 16 38328358 missense probably damaging 1.00
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0360:Maats1 UTSW 16 38298297 critical splice acceptor site probably null
R0501:Maats1 UTSW 16 38335635 missense probably damaging 1.00
R0523:Maats1 UTSW 16 38328374 missense probably damaging 1.00
R0743:Maats1 UTSW 16 38335634 missense possibly damaging 0.48
R0900:Maats1 UTSW 16 38336402 missense possibly damaging 0.70
R1218:Maats1 UTSW 16 38298133 missense probably benign
R1499:Maats1 UTSW 16 38321400 missense probably damaging 0.96
R1693:Maats1 UTSW 16 38341723 missense probably benign
R1793:Maats1 UTSW 16 38321419 missense possibly damaging 0.77
R1854:Maats1 UTSW 16 38324297 splice site probably null
R2007:Maats1 UTSW 16 38298254 missense probably benign 0.02
R2126:Maats1 UTSW 16 38341762 missense probably benign 0.19
R2443:Maats1 UTSW 16 38302732 missense probably damaging 1.00
R2857:Maats1 UTSW 16 38302713 missense probably damaging 1.00
R2937:Maats1 UTSW 16 38311038 missense possibly damaging 0.65
R3441:Maats1 UTSW 16 38333806 missense probably benign 0.03
R3442:Maats1 UTSW 16 38333806 missense probably benign 0.03
R4056:Maats1 UTSW 16 38298214 missense probably benign
R4057:Maats1 UTSW 16 38298214 missense probably benign
R4424:Maats1 UTSW 16 38320365 missense probably damaging 1.00
R4546:Maats1 UTSW 16 38335523 missense probably benign 0.11
R5177:Maats1 UTSW 16 38332321 missense probably benign 0.00
R5496:Maats1 UTSW 16 38321493 missense probably damaging 1.00
R5868:Maats1 UTSW 16 38332242 missense probably damaging 1.00
R5944:Maats1 UTSW 16 38328310 missense probably damaging 0.97
R6165:Maats1 UTSW 16 38333811 missense possibly damaging 0.93
R6521:Maats1 UTSW 16 38306759 missense probably benign 0.06
R6804:Maats1 UTSW 16 38332242 missense probably damaging 0.97
R7086:Maats1 UTSW 16 38306857 missense possibly damaging 0.70
R7202:Maats1 UTSW 16 38335597 missense probably benign 0.00
R7271:Maats1 UTSW 16 38328346 missense probably damaging 1.00
R7325:Maats1 UTSW 16 38321601 intron probably null
R7375:Maats1 UTSW 16 38335618 missense probably damaging 0.97
R7453:Maats1 UTSW 16 38321479 missense possibly damaging 0.51
R7604:Maats1 UTSW 16 38298236 nonsense probably null
X0062:Maats1 UTSW 16 38298099 missense possibly damaging 0.70
X0067:Maats1 UTSW 16 38306860 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTTTAGCACACCCTACCAGG -3'
(R):5'- TGCCAGGTTTGTTCACCCTG -3'

Sequencing Primer
(F):5'- CAGGTTACATTAGCTCCCAGGAG -3'
(R):5'- GTATCCCAAAATCTACTCTGTCGC -3'
Posted On2015-07-21