Incidental Mutation 'R4494:Olfr1297'
ID 330868
Institutional Source Beutler Lab
Gene Symbol Olfr1297
Ensembl Gene ENSMUSG00000094858
Gene Name olfactory receptor 1297
Synonyms GA_x6K02T2Q125-72673494-72672556, MOR248-4
MMRRC Submission 041582-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R4494 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111615233-111626497 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 111621148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 309 (K309*)
Ref Sequence ENSEMBL: ENSMUSP00000150543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099612] [ENSMUST00000207283] [ENSMUST00000213398]
AlphaFold Q8VGE8
Predicted Effect probably null
Transcript: ENSMUST00000099612
AA Change: K309*
SMART Domains Protein: ENSMUSP00000097207
Gene: ENSMUSG00000094858
AA Change: K309*

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7tm_1 41 287 6.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207283
AA Change: K309*
Predicted Effect probably null
Transcript: ENSMUST00000213398
AA Change: K309*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7ip T A 6: 136,563,749 probably null Het
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Camsap1 T C 2: 25,952,758 D262G probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc170 T C 10: 4,514,128 Y36H probably damaging Het
Cd177 A T 7: 24,752,003 S492T probably benign Het
Chrna4 T A 2: 181,028,488 I492F probably damaging Het
Cit T C 5: 115,873,984 Y217H probably damaging Het
Cnbd1 T A 4: 19,098,150 D90V probably benign Het
Cryba2 A G 1: 74,890,630 F116S probably damaging Het
Ctbp1 T C 5: 33,250,869 T240A possibly damaging Het
D130043K22Rik C T 13: 24,871,356 S501L probably benign Het
Ddhd2 A G 8: 25,738,234 F553S probably benign Het
Ddr2 C A 1: 169,988,414 G575W probably damaging Het
Dip2c T C 13: 9,571,062 V537A possibly damaging Het
Dnah12 C T 14: 26,871,855 A752V probably damaging Het
Dnah7a T C 1: 53,449,038 D3260G probably benign Het
Efemp2 T A 19: 5,480,311 C309S probably damaging Het
Fam46a A G 9: 85,325,047 S233P probably damaging Het
Gse1 G A 8: 120,570,814 probably benign Het
Hspa4l T C 3: 40,753,204 S53P possibly damaging Het
Ighv5-4 T C 12: 113,597,584 D72G probably benign Het
Igkv15-103 A G 6: 68,437,796 N73S probably benign Het
Igsf11 T G 16: 39,011,341 N183K possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kcnk18 T C 19: 59,234,831 V136A probably damaging Het
Krt75 A T 15: 101,571,701 Y240* probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Man2a2 C T 7: 80,359,275 probably null Het
Mme A G 3: 63,347,192 N491S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msi2 T C 11: 88,717,359 D39G possibly damaging Het
Naa60 T A 16: 3,900,721 C122* probably null Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nme6 C T 9: 109,842,054 L121F probably damaging Het
Otud1 C T 2: 19,659,335 T425I probably damaging Het
Pimreg T C 11: 72,045,138 V149A probably benign Het
Plbd1 T C 6: 136,613,858 I437V probably damaging Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Slc1a3 G A 15: 8,639,095 T462I probably damaging Het
Slc25a26 A G 6: 94,598,403 T198A probably damaging Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Svop T C 5: 114,045,627 T195A probably damaging Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Ush2a C T 1: 188,553,276 T2003I possibly damaging Het
Vmn2r17 T A 5: 109,428,469 V402E probably damaging Het
Vmn2r3 C G 3: 64,275,271 G336R probably damaging Het
Wdr89 A T 12: 75,632,747 D244E probably damaging Het
Other mutations in Olfr1297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr1297 APN 2 111621340 missense probably damaging 1.00
IGL01305:Olfr1297 APN 2 111621201 missense probably damaging 1.00
IGL01903:Olfr1297 APN 2 111621658 missense probably benign 0.01
IGL01984:Olfr1297 APN 2 111621582 missense probably benign 0.34
IGL03065:Olfr1297 APN 2 111621190 missense probably damaging 0.98
ANU22:Olfr1297 UTSW 2 111621201 missense probably damaging 1.00
R0313:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R0615:Olfr1297 UTSW 2 111621919 missense possibly damaging 0.95
R1028:Olfr1297 UTSW 2 111621525 missense probably damaging 1.00
R1078:Olfr1297 UTSW 2 111621345 missense probably damaging 1.00
R1158:Olfr1297 UTSW 2 111621741 missense probably damaging 1.00
R1419:Olfr1297 UTSW 2 111621295 missense probably benign 0.05
R1980:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R1981:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R2044:Olfr1297 UTSW 2 111621814 missense probably benign 0.02
R2080:Olfr1297 UTSW 2 111621739 missense probably benign
R2170:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R4965:Olfr1297 UTSW 2 111621534 missense probably damaging 1.00
R5175:Olfr1297 UTSW 2 111621426 missense possibly damaging 0.78
R5891:Olfr1297 UTSW 2 111621433 missense probably damaging 1.00
R6192:Olfr1297 UTSW 2 111621175 missense possibly damaging 0.91
R6383:Olfr1297 UTSW 2 111621186 missense probably benign 0.10
R6730:Olfr1297 UTSW 2 111621735 missense probably damaging 0.96
R7189:Olfr1297 UTSW 2 111621193 missense probably benign 0.03
R7193:Olfr1297 UTSW 2 111621255 missense probably damaging 1.00
R7199:Olfr1297 UTSW 2 111621193 missense probably benign 0.01
R7735:Olfr1297 UTSW 2 111621474 missense probably damaging 1.00
R8017:Olfr1297 UTSW 2 111622067 missense probably benign 0.00
R8019:Olfr1297 UTSW 2 111622067 missense probably benign 0.00
R8285:Olfr1297 UTSW 2 111622045 missense probably benign 0.32
R8419:Olfr1297 UTSW 2 111621504 missense probably benign 0.10
R9258:Olfr1297 UTSW 2 111621984 missense possibly damaging 0.77
X0063:Olfr1297 UTSW 2 111621381 missense probably benign 0.04
Z1176:Olfr1297 UTSW 2 111621261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAATGACCTGATAGCTCATC -3'
(R):5'- TGTCCACATGCACTGCACAC -3'

Sequencing Primer
(F):5'- GCTCATCAGTAAATGCCATATTTTC -3'
(R):5'- TGCACACATCACAGTGGTAATG -3'
Posted On 2015-07-21