Mutagenetix > Incidental Mutation

Incidental Mutation 'R0069:Nfx1'

33087

Institutional Source

Beutler Lab

Gene Symbol

Nfx1

Ensembl Gene

ENSMUSG00000028423

Gene Name

nuclear transcription factor, X-box binding 1

Synonyms

1300017N15Rik, Tex42, 3000003M19Rik, TEG-42

MMRRC Submission

038360-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.566) question?

Stock #

R0069 (G1)

Quality Score

Status

Validated (trace)

Chromosome

Chromosomal Location

40970906-41025993 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 40986688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000095747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]

AlphaFold

B1AY10

Predicted Effect

probably benign
Transcript: ENSMUST00000030133

SMART Domains

Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091614

SMART Domains

Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000098143

SMART Domains

Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART
ZnF_NFX	826	848	7.7e-5	SMART
ZnF_NFX	857	878	4.23e-2	SMART
coiled coil region	930	956	N/A	INTRINSIC
R3H	977	1055	1.38e-22	SMART
low complexity region	1070	1088	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.4%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	T	6: 128,561,562	C632S	probably damaging	Het
Antxr2	T	A	5: 97,948,250	M392L	possibly damaging	Het
Cd101	A	G	3: 101,008,217	V678A	probably benign	Het
Clec2g	T	A	6: 128,948,753	S42T	probably benign	Het
Clec2g	T	C	6: 128,980,311		probably null	Het
Creb1	A	G	1: 64,576,208	I240V	possibly damaging	Het
D2hgdh	G	T	1: 93,835,287	V265L	possibly damaging	Het
Dctn2	A	T	10: 127,277,485		probably null	Het
Diablo	A	T	5: 123,518,024	S117R	probably damaging	Het
Ebf2	A	T	14: 67,410,050	R349S	probably damaging	Het
Fam168a	C	T	7: 100,835,411	A252V	probably benign	Het
Fbn2	T	C	18: 58,069,184	Y1299C	probably damaging	Het
Gne	A	C	4: 44,060,099	V98G	probably damaging	Het
Hk2	A	G	6: 82,736,528		probably null	Het
Ifi206	A	T	1: 173,486,847	V9D	probably damaging	Het
Ints3	A	G	3: 90,400,647		probably benign	Het
Itgal	A	G	7: 127,310,331	T56A	probably benign	Het
Lzts3	T	A	2: 130,636,540	T213S	probably benign	Het
Map1b	A	G	13: 99,429,848	S2122P	unknown	Het
Mei4	C	T	9: 82,025,582	Q223*	probably null	Het
Mpzl3	T	C	9: 45,068,252	V167A	probably damaging	Het
Myo1d	A	G	11: 80,637,953	I681T	probably damaging	Het
Myom2	A	G	8: 15,117,624	T1070A	probably benign	Het
Nacc1	T	A	8: 84,677,199	I16F	probably damaging	Het
Olfr1335	A	T	4: 118,809,690	V58D	probably damaging	Het
Olfr952	A	G	9: 39,426,892	Y60H	probably damaging	Het
Ostm1	A	C	10: 42,692,956	D37A	probably benign	Het
Pde8a	T	C	7: 81,319,123		probably benign	Het
Pole2	A	T	12: 69,209,887	V288E	probably damaging	Het
Poteg	T	C	8: 27,447,821	S2P	probably benign	Het
Ppp2r5c	A	T	12: 110,567,770	M356L	probably benign	Het
Prkdc	G	A	16: 15,726,504	S1786N	probably benign	Het
Prox1	A	G	1: 190,160,919	V443A	possibly damaging	Het
Prpf6	T	A	2: 181,615,963		probably null	Het
Ptger1	A	T	8: 83,668,319	T142S	possibly damaging	Het
Rad54l2	C	A	9: 106,710,365	V734L	possibly damaging	Het
Rnpepl1	T	A	1: 92,918,898	N507K	possibly damaging	Het
Slc38a10	A	T	11: 120,106,502	V722E	probably damaging	Het
Slfn10-ps	A	G	11: 83,035,542		noncoding transcript	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Sult1e1	A	T	5: 87,579,897	H175Q	probably damaging	Het
Ube2e3	C	A	2: 78,919,949		probably benign	Het
Vmn1r208	A	T	13: 22,772,425	W301R	probably benign	Het
Vps13d	A	G	4: 145,062,563	I746T	probably benign	Het
Xpnpep3	T	C	15: 81,430,798	V233A	probably benign	Het
Zfp329	A	T	7: 12,810,932	S222T	probably damaging	Het
Zswim6	T	C	13: 107,738,563		noncoding transcript	Het

Other mutations in Nfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Nfx1	APN	4	40977241	missense	probably benign	0.00
IGL01998:Nfx1	APN	4	41004353	missense	probably damaging	1.00
IGL02072:Nfx1	APN	4	41016119	missense	probably benign
IGL02170:Nfx1	APN	4	41018019	missense	probably damaging	1.00
IGL02188:Nfx1	APN	4	40993827	missense	probably damaging	1.00
IGL02502:Nfx1	APN	4	40976345	splice site	probably benign
IGL02674:Nfx1	APN	4	40999717	critical splice donor site	probably null
IGL03007:Nfx1	APN	4	40984962	missense	probably benign	0.02
IGL03092:Nfx1	APN	4	41024851	missense	probably damaging	1.00
IGL03303:Nfx1	APN	4	41004323	splice site	probably benign
K7371:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
PIT4498001:Nfx1	UTSW	4	40977244	missense	probably benign
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R1056:Nfx1	UTSW	4	41003057	missense	probably damaging	0.97
R1449:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
R1635:Nfx1	UTSW	4	40977004	missense	probably benign
R1636:Nfx1	UTSW	4	41016072	splice site	probably null
R1882:Nfx1	UTSW	4	41009240	missense	possibly damaging	0.55
R2089:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R3792:Nfx1	UTSW	4	41004357	nonsense	probably null
R3793:Nfx1	UTSW	4	41004357	nonsense	probably null
R4668:Nfx1	UTSW	4	40976367	missense	possibly damaging	0.50
R4678:Nfx1	UTSW	4	41012070	missense	probably benign	0.01
R4894:Nfx1	UTSW	4	40996877	missense	probably damaging	1.00
R4972:Nfx1	UTSW	4	40976375	missense	probably benign	0.36
R5066:Nfx1	UTSW	4	40991868	missense	probably benign
R5389:Nfx1	UTSW	4	40985000	missense	probably damaging	1.00
R5429:Nfx1	UTSW	4	41004343	missense	probably damaging	1.00
R5643:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5644:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5915:Nfx1	UTSW	4	40977285	missense	probably benign	0.02
R6286:Nfx1	UTSW	4	40986728	missense	probably damaging	1.00
R6393:Nfx1	UTSW	4	40976851	missense	possibly damaging	0.92
R7409:Nfx1	UTSW	4	41021830	missense	possibly damaging	0.64
R7523:Nfx1	UTSW	4	41016119	missense	probably benign
R7916:Nfx1	UTSW	4	40977142	missense	probably benign	0.11
R8497:Nfx1	UTSW	4	40976968	missense	possibly damaging	0.67
R8799:Nfx1	UTSW	4	41023727	missense	probably damaging	1.00
R9154:Nfx1	UTSW	4	40990845	missense	probably damaging	1.00
R9364:Nfx1	UTSW	4	41023756	missense	probably benign	0.31
R9497:Nfx1	UTSW	4	40994104	missense	probably benign	0.00
X0025:Nfx1	UTSW	4	40976422	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TCGGGGTGAGAATTACATGGGACC -3'
(R):5'- CATCAGTGACTTCTGACACCAGACC -3'

Sequencing Primer
(F):5'- agtccctgcctctgtcttc -3'
(R):5'- ACTGAGGTGAGCACTACAGTG -3'

Posted On

2013-05-09