Incidental Mutation 'R4494:Slc25a26'
ID330882
Institutional Source Beutler Lab
Gene Symbol Slc25a26
Ensembl Gene ENSMUSG00000045100
Gene Namesolute carrier family 25 (mitochondrial carrier, phosphate carrier), member 26
Synonyms4930433D19Rik, 4933433F13Rik, D6Bwg0781e
MMRRC Submission 041582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4494 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location94500331-94604672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94598403 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 198 (T198A)
Ref Sequence ENSEMBL: ENSMUSP00000058028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061118] [ENSMUST00000204235] [ENSMUST00000204764]
Predicted Effect probably damaging
Transcript: ENSMUST00000061118
AA Change: T198A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058028
Gene: ENSMUSG00000045100
AA Change: T198A

DomainStartEndE-ValueType
Pfam:Mito_carr 2 82 7e-14 PFAM
Pfam:Mito_carr 84 173 4e-16 PFAM
Pfam:Mito_carr 176 269 2.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203484
Predicted Effect probably benign
Transcript: ENSMUST00000204235
SMART Domains Protein: ENSMUSP00000145328
Gene: ENSMUSG00000045100

DomainStartEndE-ValueType
Pfam:Mito_carr 2 43 2.7e-7 PFAM
Pfam:Mito_carr 38 82 8.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204764
SMART Domains Protein: ENSMUSP00000144816
Gene: ENSMUSG00000045100

DomainStartEndE-ValueType
Pfam:Mito_carr 2 44 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205173
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial carriers, including SLC25A26, are a family of transport proteins found mostly in the inner membranes of mitochondria. They shuttle metabolites and cofactors through the mitochondrial membrane (Agrimi et al., 2004 [PubMed 14674884]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Embryos homozygous for a transposon insertion appear growth retarded and underdeveloped and die after E8.5 but prior to birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7ip T A 6: 136,563,749 probably null Het
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Camsap1 T C 2: 25,952,758 D262G probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc170 T C 10: 4,514,128 Y36H probably damaging Het
Cd177 A T 7: 24,752,003 S492T probably benign Het
Chrna4 T A 2: 181,028,488 I492F probably damaging Het
Cit T C 5: 115,873,984 Y217H probably damaging Het
Cnbd1 T A 4: 19,098,150 D90V probably benign Het
Cryba2 A G 1: 74,890,630 F116S probably damaging Het
Ctbp1 T C 5: 33,250,869 T240A possibly damaging Het
D130043K22Rik C T 13: 24,871,356 S501L probably benign Het
Ddhd2 A G 8: 25,738,234 F553S probably benign Het
Ddr2 C A 1: 169,988,414 G575W probably damaging Het
Dip2c T C 13: 9,571,062 V537A possibly damaging Het
Dnah12 C T 14: 26,871,855 A752V probably damaging Het
Dnah7a T C 1: 53,449,038 D3260G probably benign Het
Efemp2 T A 19: 5,480,311 C309S probably damaging Het
Fam46a A G 9: 85,325,047 S233P probably damaging Het
Gse1 G A 8: 120,570,814 probably benign Het
Hspa4l T C 3: 40,753,204 S53P possibly damaging Het
Ighv5-4 T C 12: 113,597,584 D72G probably benign Het
Igkv15-103 A G 6: 68,437,796 N73S probably benign Het
Igsf11 T G 16: 39,011,341 N183K possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk18 T C 19: 59,234,831 V136A probably damaging Het
Krt75 A T 15: 101,571,701 Y240* probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Man2a2 C T 7: 80,359,275 probably null Het
Mme A G 3: 63,347,192 N491S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msi2 T C 11: 88,717,359 D39G possibly damaging Het
Naa60 T A 16: 3,900,721 C122* probably null Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nme6 C T 9: 109,842,054 L121F probably damaging Het
Olfr1297 T A 2: 111,621,148 K309* probably null Het
Otud1 C T 2: 19,659,335 T425I probably damaging Het
Pimreg T C 11: 72,045,138 V149A probably benign Het
Plbd1 T C 6: 136,613,858 I437V probably damaging Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Slc1a3 G A 15: 8,639,095 T462I probably damaging Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Svop T C 5: 114,045,627 T195A probably damaging Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Ush2a C T 1: 188,553,276 T2003I possibly damaging Het
Vmn2r17 T A 5: 109,428,469 V402E probably damaging Het
Vmn2r3 C G 3: 64,275,271 G336R probably damaging Het
Wdr89 A T 12: 75,632,747 D244E probably damaging Het
Other mutations in Slc25a26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Slc25a26 APN 6 94534223 missense probably damaging 0.99
IGL02208:Slc25a26 APN 6 94507539 missense probably damaging 0.99
R0147:Slc25a26 UTSW 6 94592526 intron probably null
R0244:Slc25a26 UTSW 6 94510833 missense probably damaging 1.00
R0555:Slc25a26 UTSW 6 94592410 critical splice acceptor site probably null
R0900:Slc25a26 UTSW 6 94507658 missense probably damaging 1.00
R1427:Slc25a26 UTSW 6 94510847 missense probably damaging 1.00
R4625:Slc25a26 UTSW 6 94507652 missense probably damaging 0.97
R6009:Slc25a26 UTSW 6 94510826 missense probably benign 0.00
X0066:Slc25a26 UTSW 6 94576346 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTCCAGTACGGCAAAAGATGTG -3'
(R):5'- AGTGACAGCTGCCAACATGC -3'

Sequencing Primer
(F):5'- GAGATGAACTTGTTCACGTGTATCC -3'
(R):5'- CAACATGCGGTGGCGATGAC -3'
Posted On2015-07-21