Incidental Mutation 'R4494:Plbd1'
ID330886
Institutional Source Beutler Lab
Gene Symbol Plbd1
Ensembl Gene ENSMUSG00000030214
Gene Namephospholipase B domain containing 1
Synonyms1100001H23Rik
MMRRC Submission 041582-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4494 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136612070-136661928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136613858 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 437 (I437V)
Ref Sequence ENSEMBL: ENSMUSP00000032336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032335] [ENSMUST00000032336]
Predicted Effect probably benign
Transcript: ENSMUST00000032335
SMART Domains Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213

DomainStartEndE-ValueType
internal_repeat_1 123 144 9.59e-5 PROSPERO
internal_repeat_1 143 164 9.59e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
Pfam:ATF7IP_BD 598 813 5.5e-62 PFAM
low complexity region 864 889 N/A INTRINSIC
PDB:2RPQ|B 974 1017 5e-7 PDB
low complexity region 1022 1036 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1168 1192 N/A INTRINSIC
FN3 1194 1288 3.4e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000032336
AA Change: I437V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032336
Gene: ENSMUSG00000030214
AA Change: I437V

DomainStartEndE-ValueType
Pfam:Phospholip_B 16 545 3.7e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137139
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7ip T A 6: 136,563,749 probably null Het
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Camsap1 T C 2: 25,952,758 D262G probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc170 T C 10: 4,514,128 Y36H probably damaging Het
Cd177 A T 7: 24,752,003 S492T probably benign Het
Chrna4 T A 2: 181,028,488 I492F probably damaging Het
Cit T C 5: 115,873,984 Y217H probably damaging Het
Cnbd1 T A 4: 19,098,150 D90V probably benign Het
Cryba2 A G 1: 74,890,630 F116S probably damaging Het
Ctbp1 T C 5: 33,250,869 T240A possibly damaging Het
D130043K22Rik C T 13: 24,871,356 S501L probably benign Het
Ddhd2 A G 8: 25,738,234 F553S probably benign Het
Ddr2 C A 1: 169,988,414 G575W probably damaging Het
Dip2c T C 13: 9,571,062 V537A possibly damaging Het
Dnah12 C T 14: 26,871,855 A752V probably damaging Het
Dnah7a T C 1: 53,449,038 D3260G probably benign Het
Efemp2 T A 19: 5,480,311 C309S probably damaging Het
Fam46a A G 9: 85,325,047 S233P probably damaging Het
Gse1 G A 8: 120,570,814 probably benign Het
Hspa4l T C 3: 40,753,204 S53P possibly damaging Het
Ighv5-4 T C 12: 113,597,584 D72G probably benign Het
Igkv15-103 A G 6: 68,437,796 N73S probably benign Het
Igsf11 T G 16: 39,011,341 N183K possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk18 T C 19: 59,234,831 V136A probably damaging Het
Krt75 A T 15: 101,571,701 Y240* probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Man2a2 C T 7: 80,359,275 probably null Het
Mme A G 3: 63,347,192 N491S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msi2 T C 11: 88,717,359 D39G possibly damaging Het
Naa60 T A 16: 3,900,721 C122* probably null Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nme6 C T 9: 109,842,054 L121F probably damaging Het
Olfr1297 T A 2: 111,621,148 K309* probably null Het
Otud1 C T 2: 19,659,335 T425I probably damaging Het
Pimreg T C 11: 72,045,138 V149A probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Slc1a3 G A 15: 8,639,095 T462I probably damaging Het
Slc25a26 A G 6: 94,598,403 T198A probably damaging Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Svop T C 5: 114,045,627 T195A probably damaging Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Ush2a C T 1: 188,553,276 T2003I possibly damaging Het
Vmn2r17 T A 5: 109,428,469 V402E probably damaging Het
Vmn2r3 C G 3: 64,275,271 G336R probably damaging Het
Wdr89 A T 12: 75,632,747 D244E probably damaging Het
Other mutations in Plbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Plbd1 APN 6 136634470 missense probably benign
IGL02131:Plbd1 APN 6 136661683 utr 5 prime probably benign
R0355:Plbd1 UTSW 6 136641167 missense possibly damaging 0.71
R0762:Plbd1 UTSW 6 136641147 missense probably damaging 1.00
R1019:Plbd1 UTSW 6 136651905 missense probably benign 0.03
R1456:Plbd1 UTSW 6 136613816 missense probably benign 0.12
R1607:Plbd1 UTSW 6 136612306 missense probably benign 0.04
R1640:Plbd1 UTSW 6 136640125 missense probably benign 0.00
R2166:Plbd1 UTSW 6 136613790 critical splice donor site probably null
R2909:Plbd1 UTSW 6 136634574 missense probably damaging 1.00
R4529:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R4530:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R5206:Plbd1 UTSW 6 136641156 missense probably benign 0.17
R5272:Plbd1 UTSW 6 136640158 missense probably damaging 1.00
R5522:Plbd1 UTSW 6 136617300 missense probably benign 0.31
R5649:Plbd1 UTSW 6 136616989 missense probably benign 0.01
R5879:Plbd1 UTSW 6 136634505 missense probably damaging 1.00
R5940:Plbd1 UTSW 6 136613721 intron probably benign
R6311:Plbd1 UTSW 6 136613947 missense probably benign 0.09
R6590:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6657:Plbd1 UTSW 6 136617252 missense probably damaging 0.99
R6690:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6842:Plbd1 UTSW 6 136635614 missense probably benign 0.05
R6938:Plbd1 UTSW 6 136616987 missense probably benign 0.00
R7000:Plbd1 UTSW 6 136612838 missense probably benign 0.21
R7214:Plbd1 UTSW 6 136612831 missense probably damaging 1.00
R7654:Plbd1 UTSW 6 136651866 missense possibly damaging 0.47
R7744:Plbd1 UTSW 6 136617246 missense probably benign 0.00
R7870:Plbd1 UTSW 6 136617328 missense possibly damaging 0.81
R7953:Plbd1 UTSW 6 136617328 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GTTGAGCCATATGTGTACAGC -3'
(R):5'- AGAAGGACCACTGTGACCTG -3'

Sequencing Primer
(F):5'- GAGCCATATGTGTACAGCATTAG -3'
(R):5'- TGCAGGTTCATTTCCTAAGTAATTAC -3'
Posted On2015-07-21