Incidental Mutation 'R0069:Olfr1335'
ID33089
Institutional Source Beutler Lab
Gene Symbol Olfr1335
Ensembl Gene ENSMUSG00000066061
Gene Nameolfactory receptor 1335
SynonymsGA_x6K02T2QD9B-18723799-18724749, GA_x6K02T2QD9B-18726774-18727577, MOR259-12, MOR259-5, Olfr1334-ps1, Olfr1335
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0069 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location118808797-118809944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118809690 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 58 (V58D)
Ref Sequence ENSEMBL: ENSMUSP00000151219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084313] [ENSMUST00000105035] [ENSMUST00000219094]
Predicted Effect probably damaging
Transcript: ENSMUST00000084313
AA Change: V42D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081339
Gene: ENSMUSG00000066061
AA Change: V42D

DomainStartEndE-ValueType
Pfam:7tm_4 50 326 2.3e-56 PFAM
Pfam:7TM_GPCR_Srsx 54 323 3.7e-8 PFAM
Pfam:7tm_1 60 309 2.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105035
AA Change: V42D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100652
Gene: ENSMUSG00000073768
AA Change: V42D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 307 6.4e-8 PFAM
Pfam:7tm_1 44 293 2.9e-31 PFAM
Pfam:7tm_4 142 286 6.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219094
AA Change: V58D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ifi206 A T 1: 173,486,847 V9D probably damaging Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Olfr1335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr1335 APN 4 118809456 missense probably damaging 0.98
IGL02481:Olfr1335 APN 4 118809499 missense probably benign 0.01
IGL02483:Olfr1335 APN 4 118809499 missense probably benign 0.01
R0058:Olfr1335 UTSW 4 118809480 missense probably benign
R0357:Olfr1335 UTSW 4 118809417 missense probably damaging 1.00
R1274:Olfr1335 UTSW 4 118809396 missense probably benign 0.01
R1432:Olfr1335 UTSW 4 118809238 missense probably benign 0.00
R2305:Olfr1335 UTSW 4 118808861 missense probably benign 0.35
R2368:Olfr1335 UTSW 4 118809822 missense probably benign
R3842:Olfr1335 UTSW 4 118809255 missense probably damaging 1.00
R3980:Olfr1335 UTSW 4 118809303 missense probably benign 0.22
R4722:Olfr1335 UTSW 4 118808949 missense probably damaging 0.99
R5074:Olfr1335 UTSW 4 118808860 missense possibly damaging 0.82
R5439:Olfr1335 UTSW 4 118809363 missense possibly damaging 0.95
R5930:Olfr1335 UTSW 4 118809378 missense probably benign 0.01
R6917:Olfr1335 UTSW 4 118809129 missense probably damaging 1.00
R7287:Olfr1335 UTSW 4 118809742 missense probably benign 0.01
R7525:Olfr1335 UTSW 4 118809494 missense probably damaging 0.99
X0023:Olfr1335 UTSW 4 118809621 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATGACAACAAAGAGGATGCTC -3'
(R):5'- ACTGCTGCCATGTGTCAGACAAC -3'

Sequencing Primer
(F):5'- AAGAGGATGCTCTCTGTCATACC -3'
(R):5'- GCCATGTGTCAGACAACACATAG -3'
Posted On2013-05-09