Incidental Mutation 'R4494:Fam46a'
ID330891
Institutional Source Beutler Lab
Gene Symbol Fam46a
Ensembl Gene ENSMUSG00000032265
Gene Namefamily with sequence similarity 46, member A
SynonymsD930050G01Rik
MMRRC Submission 041582-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R4494 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location85320439-85327348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85325047 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 233 (S233P)
Ref Sequence ENSEMBL: ENSMUSP00000140869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034802] [ENSMUST00000187711]
Predicted Effect probably damaging
Transcript: ENSMUST00000034802
AA Change: S252P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034802
Gene: ENSMUSG00000032265
AA Change: S252P

DomainStartEndE-ValueType
low complexity region 43 55 N/A INTRINSIC
DUF1693 71 389 8.01e-244 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187711
AA Change: S233P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140869
Gene: ENSMUSG00000032265
AA Change: S233P

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
DUF1693 52 370 3.9e-248 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for an ENU-induced allele show partial lethality, high alkaline phosphatase (ALP) activity, short stature, and limb, long bone, rib, pelvis and skull anomalies, with absent trabeculae and reduced cortical thickness in long bones. Heterozygotes show high ALP activity but no other defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7ip T A 6: 136,563,749 probably null Het
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Camsap1 T C 2: 25,952,758 D262G probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc170 T C 10: 4,514,128 Y36H probably damaging Het
Cd177 A T 7: 24,752,003 S492T probably benign Het
Chrna4 T A 2: 181,028,488 I492F probably damaging Het
Cit T C 5: 115,873,984 Y217H probably damaging Het
Cnbd1 T A 4: 19,098,150 D90V probably benign Het
Cryba2 A G 1: 74,890,630 F116S probably damaging Het
Ctbp1 T C 5: 33,250,869 T240A possibly damaging Het
D130043K22Rik C T 13: 24,871,356 S501L probably benign Het
Ddhd2 A G 8: 25,738,234 F553S probably benign Het
Ddr2 C A 1: 169,988,414 G575W probably damaging Het
Dip2c T C 13: 9,571,062 V537A possibly damaging Het
Dnah12 C T 14: 26,871,855 A752V probably damaging Het
Dnah7a T C 1: 53,449,038 D3260G probably benign Het
Efemp2 T A 19: 5,480,311 C309S probably damaging Het
Gse1 G A 8: 120,570,814 probably benign Het
Hspa4l T C 3: 40,753,204 S53P possibly damaging Het
Ighv5-4 T C 12: 113,597,584 D72G probably benign Het
Igkv15-103 A G 6: 68,437,796 N73S probably benign Het
Igsf11 T G 16: 39,011,341 N183K possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk18 T C 19: 59,234,831 V136A probably damaging Het
Krt75 A T 15: 101,571,701 Y240* probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Man2a2 C T 7: 80,359,275 probably null Het
Mme A G 3: 63,347,192 N491S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msi2 T C 11: 88,717,359 D39G possibly damaging Het
Naa60 T A 16: 3,900,721 C122* probably null Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nme6 C T 9: 109,842,054 L121F probably damaging Het
Olfr1297 T A 2: 111,621,148 K309* probably null Het
Otud1 C T 2: 19,659,335 T425I probably damaging Het
Pimreg T C 11: 72,045,138 V149A probably benign Het
Plbd1 T C 6: 136,613,858 I437V probably damaging Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Slc1a3 G A 15: 8,639,095 T462I probably damaging Het
Slc25a26 A G 6: 94,598,403 T198A probably damaging Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Svop T C 5: 114,045,627 T195A probably damaging Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Ush2a C T 1: 188,553,276 T2003I possibly damaging Het
Vmn2r17 T A 5: 109,428,469 V402E probably damaging Het
Vmn2r3 C G 3: 64,275,271 G336R probably damaging Het
Wdr89 A T 12: 75,632,747 D244E probably damaging Het
Other mutations in Fam46a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Fam46a APN 9 85324753 missense possibly damaging 0.94
IGL01135:Fam46a APN 9 85326599 missense probably damaging 0.97
IGL01724:Fam46a APN 9 85325050 missense probably damaging 0.99
IGL02798:Fam46a APN 9 85324884 missense probably damaging 1.00
R0482:Fam46a UTSW 9 85325055 missense probably damaging 1.00
R2697:Fam46a UTSW 9 85324740 missense possibly damaging 0.48
R4458:Fam46a UTSW 9 85326474 missense possibly damaging 0.75
R5245:Fam46a UTSW 9 85326348 missense possibly damaging 0.46
R6539:Fam46a UTSW 9 85326561 missense possibly damaging 0.75
R6622:Fam46a UTSW 9 85326456 missense probably damaging 0.99
R7253:Fam46a UTSW 9 85326717 missense probably benign 0.01
R7317:Fam46a UTSW 9 85324617 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGAGGGTCTTGATCTCCTC -3'
(R):5'- TACATCGTAGGAGGCTTATGTG -3'

Sequencing Primer
(F):5'- TCTTGATCTCCTCGGAGGCAG -3'
(R):5'- TGTGCAGAAAATGGTTAAAGTGTGC -3'
Posted On2015-07-21