Incidental Mutation 'R4494:Ccdc170'
ID330894
Institutional Source Beutler Lab
Gene Symbol Ccdc170
Ensembl Gene ENSMUSG00000019767
Gene Namecoiled-coil domain containing 170
SynonymsGm221, LOC237250
MMRRC Submission 041582-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R4494 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location4482502-4562231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4514128 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 36 (Y36H)
Ref Sequence ENSEMBL: ENSMUSP00000122673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019901] [ENSMUST00000138112] [ENSMUST00000145465]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019901
AA Change: Y84H

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019901
Gene: ENSMUSG00000019767
AA Change: Y84H

DomainStartEndE-ValueType
coiled coil region 40 160 N/A INTRINSIC
coiled coil region 264 302 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
coiled coil region 379 415 N/A INTRINSIC
coiled coil region 475 649 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138112
AA Change: Y90H

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115997
Gene: ENSMUSG00000019767
AA Change: Y90H

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
internal_repeat_1 80 93 6.25e-5 PROSPERO
internal_repeat_1 305 318 6.25e-5 PROSPERO
low complexity region 351 363 N/A INTRINSIC
coiled coil region 385 421 N/A INTRINSIC
coiled coil region 481 655 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145465
AA Change: Y36H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122673
Gene: ENSMUSG00000019767
AA Change: Y36H

DomainStartEndE-ValueType
coiled coil region 6 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene and its encoded protein is not known. Several genome-wide association studies have implicated the region around this gene to be involved in breast cancer and bone mineral density, but no link to this specific gene has been found. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7ip T A 6: 136,563,749 probably null Het
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Camsap1 T C 2: 25,952,758 D262G probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cd177 A T 7: 24,752,003 S492T probably benign Het
Chrna4 T A 2: 181,028,488 I492F probably damaging Het
Cit T C 5: 115,873,984 Y217H probably damaging Het
Cnbd1 T A 4: 19,098,150 D90V probably benign Het
Cryba2 A G 1: 74,890,630 F116S probably damaging Het
Ctbp1 T C 5: 33,250,869 T240A possibly damaging Het
D130043K22Rik C T 13: 24,871,356 S501L probably benign Het
Ddhd2 A G 8: 25,738,234 F553S probably benign Het
Ddr2 C A 1: 169,988,414 G575W probably damaging Het
Dip2c T C 13: 9,571,062 V537A possibly damaging Het
Dnah12 C T 14: 26,871,855 A752V probably damaging Het
Dnah7a T C 1: 53,449,038 D3260G probably benign Het
Efemp2 T A 19: 5,480,311 C309S probably damaging Het
Fam46a A G 9: 85,325,047 S233P probably damaging Het
Gse1 G A 8: 120,570,814 probably benign Het
Hspa4l T C 3: 40,753,204 S53P possibly damaging Het
Ighv5-4 T C 12: 113,597,584 D72G probably benign Het
Igkv15-103 A G 6: 68,437,796 N73S probably benign Het
Igsf11 T G 16: 39,011,341 N183K possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk18 T C 19: 59,234,831 V136A probably damaging Het
Krt75 A T 15: 101,571,701 Y240* probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Man2a2 C T 7: 80,359,275 probably null Het
Mme A G 3: 63,347,192 N491S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msi2 T C 11: 88,717,359 D39G possibly damaging Het
Naa60 T A 16: 3,900,721 C122* probably null Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nme6 C T 9: 109,842,054 L121F probably damaging Het
Olfr1297 T A 2: 111,621,148 K309* probably null Het
Otud1 C T 2: 19,659,335 T425I probably damaging Het
Pimreg T C 11: 72,045,138 V149A probably benign Het
Plbd1 T C 6: 136,613,858 I437V probably damaging Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Slc1a3 G A 15: 8,639,095 T462I probably damaging Het
Slc25a26 A G 6: 94,598,403 T198A probably damaging Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Svop T C 5: 114,045,627 T195A probably damaging Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Ush2a C T 1: 188,553,276 T2003I possibly damaging Het
Vmn2r17 T A 5: 109,428,469 V402E probably damaging Het
Vmn2r3 C G 3: 64,275,271 G336R probably damaging Het
Wdr89 A T 12: 75,632,747 D244E probably damaging Het
Other mutations in Ccdc170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc170 APN 10 4546836 missense probably damaging 1.00
IGL01018:Ccdc170 APN 10 4512788 missense probably benign
IGL01018:Ccdc170 APN 10 4514155 missense probably benign 0.00
IGL01018:Ccdc170 APN 10 4514114 missense probably benign
IGL01114:Ccdc170 APN 10 4558550 missense probably benign 0.01
IGL01377:Ccdc170 APN 10 4560966 missense probably damaging 1.00
IGL01726:Ccdc170 APN 10 4549713 missense probably benign 0.04
IGL02110:Ccdc170 APN 10 4541885 splice site probably null
FR4304:Ccdc170 UTSW 10 4561021 small insertion probably benign
FR4548:Ccdc170 UTSW 10 4561026 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561029 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561008 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561029 small insertion probably benign
R0137:Ccdc170 UTSW 10 4546950 splice site probably benign
R0280:Ccdc170 UTSW 10 4558663 missense possibly damaging 0.62
R0480:Ccdc170 UTSW 10 4518939 missense probably benign 0.00
R1786:Ccdc170 UTSW 10 4519043 missense probably benign 0.02
R2383:Ccdc170 UTSW 10 4534208 missense probably benign 0.00
R3031:Ccdc170 UTSW 10 4518931 missense probably damaging 0.99
R3797:Ccdc170 UTSW 10 4560920 missense possibly damaging 0.60
R4916:Ccdc170 UTSW 10 4518971 missense probably damaging 0.96
R5152:Ccdc170 UTSW 10 4561107 missense probably damaging 1.00
R5170:Ccdc170 UTSW 10 4514200 missense probably damaging 0.99
R5354:Ccdc170 UTSW 10 4534188 missense probably benign 0.16
R5911:Ccdc170 UTSW 10 4558551 nonsense probably null
R5983:Ccdc170 UTSW 10 4520851 nonsense probably null
R6374:Ccdc170 UTSW 10 4549746 nonsense probably null
R6645:Ccdc170 UTSW 10 4560974 missense possibly damaging 0.95
R6818:Ccdc170 UTSW 10 4541782 missense probably damaging 1.00
R6888:Ccdc170 UTSW 10 4546854 missense possibly damaging 0.91
R7032:Ccdc170 UTSW 10 4482597 missense unknown
R7206:Ccdc170 UTSW 10 4514120 missense possibly damaging 0.66
R7393:Ccdc170 UTSW 10 4514314 critical splice donor site probably null
R7438:Ccdc170 UTSW 10 4558512 nonsense probably null
R7471:Ccdc170 UTSW 10 4520803 missense probably benign 0.00
R7514:Ccdc170 UTSW 10 4546839 missense probably benign 0.37
R7818:Ccdc170 UTSW 10 4549603 missense probably benign 0.05
RF006:Ccdc170 UTSW 10 4561030 small insertion probably benign
RF009:Ccdc170 UTSW 10 4561030 small insertion probably benign
RF011:Ccdc170 UTSW 10 4561018 small insertion probably benign
RF017:Ccdc170 UTSW 10 4561024 small insertion probably benign
RF023:Ccdc170 UTSW 10 4561018 small insertion probably benign
RF024:Ccdc170 UTSW 10 4561024 small insertion probably benign
RF025:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF027:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF029:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF050:Ccdc170 UTSW 10 4561008 small insertion probably benign
RF064:Ccdc170 UTSW 10 4561025 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCCGAGTGGCATGAAATCAAC -3'
(R):5'- TAGCCACTAACAAACTGGGG -3'

Sequencing Primer
(F):5'- GGCATGAAATCAACTTAAGATGCTGC -3'
(R):5'- CCACTAACAAACTGGGGGATGTTTC -3'
Posted On2015-07-21