Mutagenetix > Incidental Mutation

Incidental Mutation 'R4494:D130043K22Rik'

330902

Institutional Source

Beutler Lab

Gene Symbol

D130043K22Rik

Ensembl Gene

ENSMUSG00000006711

Gene Name

RIKEN cDNA D130043K22 gene

Synonyms

MMRRC Submission

041582-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4494 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24845135-24901270 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24871356 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 501 (S501L)

Ref Sequence

ENSEMBL: ENSMUSP00000116004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]

AlphaFold

Q5SZV5

Predicted Effect

probably benign
Transcript: ENSMUST00000006893
AA Change: S501L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: S501L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Blast:MANEC	23	102	3e-44	BLAST
low complexity region	236	270	N/A	INTRINSIC
FN3	332	427	3.43e1	SMART
PKD	345	436	3.96e0	SMART
FN3	435	521	3.08e1	SMART
PKD	444	533	7.12e-10	SMART
PKD	539	629	1.46e-6	SMART
PKD	630	723	6.75e-11	SMART
FN3	634	711	5.1e1	SMART
FN3	728	808	9.15e1	SMART
PKD	729	820	4.38e-10	SMART
transmembrane domain	965	987	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141572
AA Change: S501L

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711
AA Change: S501L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Blast:MANEC	23	102	2e-44	BLAST
low complexity region	236	270	N/A	INTRINSIC
FN3	332	427	3.43e1	SMART
PKD	345	436	3.96e0	SMART
FN3	435	521	3.08e1	SMART
PKD	444	533	7.12e-10	SMART
PKD	539	629	1.46e-6	SMART
PKD	630	723	6.75e-11	SMART
FN3	634	711	5.1e1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atf7ip	T	A	6: 136,563,749		probably null	Het
Cacna1b	T	C	2: 24,652,938	T1301A	probably damaging	Het
Calcr	A	T	6: 3,708,484		probably null	Het
Camsap1	T	C	2: 25,952,758	D262G	probably damaging	Het
Ccdc141	A	G	2: 77,132,297	V101A	probably damaging	Het
Ccdc170	T	C	10: 4,514,128	Y36H	probably damaging	Het
Cd177	A	T	7: 24,752,003	S492T	probably benign	Het
Chrna4	T	A	2: 181,028,488	I492F	probably damaging	Het
Cit	T	C	5: 115,873,984	Y217H	probably damaging	Het
Cnbd1	T	A	4: 19,098,150	D90V	probably benign	Het
Cryba2	A	G	1: 74,890,630	F116S	probably damaging	Het
Ctbp1	T	C	5: 33,250,869	T240A	possibly damaging	Het
Ddhd2	A	G	8: 25,738,234	F553S	probably benign	Het
Ddr2	C	A	1: 169,988,414	G575W	probably damaging	Het
Dip2c	T	C	13: 9,571,062	V537A	possibly damaging	Het
Dnah12	C	T	14: 26,871,855	A752V	probably damaging	Het
Dnah7a	T	C	1: 53,449,038	D3260G	probably benign	Het
Efemp2	T	A	19: 5,480,311	C309S	probably damaging	Het
Fam46a	A	G	9: 85,325,047	S233P	probably damaging	Het
Gse1	G	A	8: 120,570,814		probably benign	Het
Hspa4l	T	C	3: 40,753,204	S53P	possibly damaging	Het
Ighv5-4	T	C	12: 113,597,584	D72G	probably benign	Het
Igkv15-103	A	G	6: 68,437,796	N73S	probably benign	Het
Igsf11	T	G	16: 39,011,341	N183K	possibly damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kcnk18	T	C	19: 59,234,831	V136A	probably damaging	Het
Krt75	A	T	15: 101,571,701	Y240*	probably null	Het
Lyst	G	A	13: 13,635,383	R546H	probably damaging	Het
Man2a2	C	T	7: 80,359,275		probably null	Het
Mme	A	G	3: 63,347,192	N491S	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Msi2	T	C	11: 88,717,359	D39G	possibly damaging	Het
Naa60	T	A	16: 3,900,721	C122*	probably null	Het
Nes	A	G	3: 87,976,813	E793G	probably damaging	Het
Nfkb2	A	G	19: 46,308,439	D316G	probably damaging	Het
Nme6	C	T	9: 109,842,054	L121F	probably damaging	Het
Olfr1297	T	A	2: 111,621,148	K309*	probably null	Het
Otud1	C	T	2: 19,659,335	T425I	probably damaging	Het
Pimreg	T	C	11: 72,045,138	V149A	probably benign	Het
Plbd1	T	C	6: 136,613,858	I437V	probably damaging	Het
Prlhr	A	T	19: 60,467,081	M349K	probably benign	Het
Slc1a3	G	A	15: 8,639,095	T462I	probably damaging	Het
Slc25a26	A	G	6: 94,598,403	T198A	probably damaging	Het
Stkld1	A	G	2: 26,946,626	N268S	probably benign	Het
Svop	T	C	5: 114,045,627	T195A	probably damaging	Het
Syt6	A	G	3: 103,585,630	E66G	probably damaging	Het
Tas2r129	A	G	6: 132,951,354	I85V	probably benign	Het
Tprn	T	C	2: 25,268,892	S643P	probably damaging	Het
Ush2a	C	T	1: 188,553,276	T2003I	possibly damaging	Het
Vmn2r17	T	A	5: 109,428,469	V402E	probably damaging	Het
Vmn2r3	C	G	3: 64,275,271	G336R	probably damaging	Het
Wdr89	A	T	12: 75,632,747	D244E	probably damaging	Het

Other mutations in D130043K22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:D130043K22Rik	APN	13	24867174	missense	probably damaging	1.00
IGL01114:D130043K22Rik	APN	13	24857156	missense	probably damaging	0.99
IGL01412:D130043K22Rik	APN	13	24887860	missense	probably damaging	1.00
IGL01542:D130043K22Rik	APN	13	24876037	splice site	probably null
IGL01615:D130043K22Rik	APN	13	24899796	missense	probably damaging	1.00
IGL01705:D130043K22Rik	APN	13	24857941	missense	probably benign	0.00
IGL02220:D130043K22Rik	APN	13	24883755	missense	possibly damaging	0.95
IGL02229:D130043K22Rik	APN	13	24875924	missense	probably damaging	1.00
IGL02576:D130043K22Rik	APN	13	24856870	missense	possibly damaging	0.74
IGL03038:D130043K22Rik	APN	13	24879619	missense	probably damaging	1.00
IGL03117:D130043K22Rik	APN	13	24889842	missense	probably damaging	1.00
IGL03014:D130043K22Rik	UTSW	13	24858092	missense	possibly damaging	0.88
R0019:D130043K22Rik	UTSW	13	24880812	missense	probably damaging	1.00
R0019:D130043K22Rik	UTSW	13	24880812	missense	probably damaging	1.00
R0020:D130043K22Rik	UTSW	13	24854492	utr 5 prime	probably benign
R0172:D130043K22Rik	UTSW	13	24872406	missense	probably benign	0.16
R0276:D130043K22Rik	UTSW	13	24858045	missense	possibly damaging	0.92
R0304:D130043K22Rik	UTSW	13	24864815	missense	probably benign	0.07
R0335:D130043K22Rik	UTSW	13	24887877	missense	probably damaging	0.98
R0744:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R0833:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R0836:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R1270:D130043K22Rik	UTSW	13	24857338	missense	probably benign	0.00
R1433:D130043K22Rik	UTSW	13	24871341	missense	probably damaging	1.00
R1682:D130043K22Rik	UTSW	13	24882556	missense	probably damaging	1.00
R1772:D130043K22Rik	UTSW	13	24875999	missense	probably damaging	1.00
R1773:D130043K22Rik	UTSW	13	24882602	missense	possibly damaging	0.80
R1800:D130043K22Rik	UTSW	13	24883894	missense	probably damaging	1.00
R1956:D130043K22Rik	UTSW	13	24885595	missense	probably damaging	1.00
R2255:D130043K22Rik	UTSW	13	24856911	missense	probably damaging	1.00
R2445:D130043K22Rik	UTSW	13	24857036	missense	probably benign	0.04
R2568:D130043K22Rik	UTSW	13	24883891	missense	probably damaging	0.97
R4160:D130043K22Rik	UTSW	13	24862696	missense	probably benign	0.02
R4732:D130043K22Rik	UTSW	13	24899665	missense	probably damaging	1.00
R4733:D130043K22Rik	UTSW	13	24899665	missense	probably damaging	1.00
R4782:D130043K22Rik	UTSW	13	24878040	missense	probably damaging	1.00
R4799:D130043K22Rik	UTSW	13	24878040	missense	probably damaging	1.00
R4864:D130043K22Rik	UTSW	13	24863612	missense	probably damaging	1.00
R5155:D130043K22Rik	UTSW	13	24872290	missense	probably damaging	1.00
R5240:D130043K22Rik	UTSW	13	24877977	missense	probably damaging	1.00
R5383:D130043K22Rik	UTSW	13	24857414	missense	probably benign	0.02
R5493:D130043K22Rik	UTSW	13	24863603	missense	probably damaging	1.00
R6184:D130043K22Rik	UTSW	13	24885591	missense	probably damaging	1.00
R6305:D130043K22Rik	UTSW	13	24885685	missense	probably damaging	1.00
R6436:D130043K22Rik	UTSW	13	24877935	missense	probably damaging	1.00
R6980:D130043K22Rik	UTSW	13	24864781	missense	probably damaging	0.98
R7038:D130043K22Rik	UTSW	13	24893408	missense	probably damaging	1.00
R7085:D130043K22Rik	UTSW	13	24872302	missense	possibly damaging	0.95
R7147:D130043K22Rik	UTSW	13	24882563	missense	probably benign	0.31
R7384:D130043K22Rik	UTSW	13	24882605	missense	probably damaging	1.00
R7398:D130043K22Rik	UTSW	13	24893377	missense	probably damaging	0.97
R7584:D130043K22Rik	UTSW	13	24872370	missense	probably damaging	1.00
R7585:D130043K22Rik	UTSW	13	24885585	missense	probably benign	0.01
R7588:D130043K22Rik	UTSW	13	24887893	missense	probably damaging	0.99
R7610:D130043K22Rik	UTSW	13	24876002	missense	probably benign	0.30
R7903:D130043K22Rik	UTSW	13	24876012	missense	probably damaging	0.98
R7966:D130043K22Rik	UTSW	13	24893423	missense	probably damaging	1.00
R8014:D130043K22Rik	UTSW	13	24856702	missense	probably damaging	1.00
R8374:D130043K22Rik	UTSW	13	24857979	missense	probably benign	0.07
R8543:D130043K22Rik	UTSW	13	24889869	missense	probably benign	0.08
R8775:D130043K22Rik	UTSW	13	24856999	nonsense	probably null
R8775-TAIL:D130043K22Rik	UTSW	13	24856999	nonsense	probably null
R8806:D130043K22Rik	UTSW	13	24899635	missense	probably benign	0.11
R8916:D130043K22Rik	UTSW	13	24872271	missense	probably benign
R9209:D130043K22Rik	UTSW	13	24857107	missense	possibly damaging	0.96
R9524:D130043K22Rik	UTSW	13	24887893	missense	possibly damaging	0.89
Z1177:D130043K22Rik	UTSW	13	24856709	missense	probably damaging	1.00
Z1177:D130043K22Rik	UTSW	13	24856834	missense	probably benign	0.39
Z1177:D130043K22Rik	UTSW	13	24872248	missense	possibly damaging	0.79
Z1177:D130043K22Rik	UTSW	13	24880847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGCAATGCCCAATGTATATG -3'
(R):5'- GCTCATTTTGAGGTCATGGAC -3'

Sequencing Primer
(F):5'- GCCCAATGTATATGGTTGAGATCC -3'
(R):5'- TGGACTAGGGGAAAGATTTTACTCC -3'

Posted On

2015-07-21