Incidental Mutation 'R4494:Slc1a3'
ID330904
Institutional Source Beutler Lab
Gene Symbol Slc1a3
Ensembl Gene ENSMUSG00000005360
Gene Namesolute carrier family 1 (glial high affinity glutamate transporter), member 3
SynonymsGLAST, MGluT1, Gmt1, B430115D02Rik, Eaat1
MMRRC Submission 041582-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4494 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location8634124-8710764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8639095 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 462 (T462I)
Ref Sequence ENSEMBL: ENSMUSP00000005493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005493]
Predicted Effect probably damaging
Transcript: ENSMUST00000005493
AA Change: T462I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005493
Gene: ENSMUSG00000005360
AA Change: T462I

DomainStartEndE-ValueType
Pfam:SDF 50 497 8.5e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128879
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a member of a high affinity glutamate transporter family. This gene functions in the termination of excitatory neurotransmission in central nervous system. Mutations are associated with episodic ataxia, Type 6. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormalities with respect to appearance or survival but do display functional abnormalities related to the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7ip T A 6: 136,563,749 probably null Het
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Camsap1 T C 2: 25,952,758 D262G probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc170 T C 10: 4,514,128 Y36H probably damaging Het
Cd177 A T 7: 24,752,003 S492T probably benign Het
Chrna4 T A 2: 181,028,488 I492F probably damaging Het
Cit T C 5: 115,873,984 Y217H probably damaging Het
Cnbd1 T A 4: 19,098,150 D90V probably benign Het
Cryba2 A G 1: 74,890,630 F116S probably damaging Het
Ctbp1 T C 5: 33,250,869 T240A possibly damaging Het
D130043K22Rik C T 13: 24,871,356 S501L probably benign Het
Ddhd2 A G 8: 25,738,234 F553S probably benign Het
Ddr2 C A 1: 169,988,414 G575W probably damaging Het
Dip2c T C 13: 9,571,062 V537A possibly damaging Het
Dnah12 C T 14: 26,871,855 A752V probably damaging Het
Dnah7a T C 1: 53,449,038 D3260G probably benign Het
Efemp2 T A 19: 5,480,311 C309S probably damaging Het
Fam46a A G 9: 85,325,047 S233P probably damaging Het
Gse1 G A 8: 120,570,814 probably benign Het
Hspa4l T C 3: 40,753,204 S53P possibly damaging Het
Ighv5-4 T C 12: 113,597,584 D72G probably benign Het
Igkv15-103 A G 6: 68,437,796 N73S probably benign Het
Igsf11 T G 16: 39,011,341 N183K possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk18 T C 19: 59,234,831 V136A probably damaging Het
Krt75 A T 15: 101,571,701 Y240* probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Man2a2 C T 7: 80,359,275 probably null Het
Mme A G 3: 63,347,192 N491S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msi2 T C 11: 88,717,359 D39G possibly damaging Het
Naa60 T A 16: 3,900,721 C122* probably null Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nme6 C T 9: 109,842,054 L121F probably damaging Het
Olfr1297 T A 2: 111,621,148 K309* probably null Het
Otud1 C T 2: 19,659,335 T425I probably damaging Het
Pimreg T C 11: 72,045,138 V149A probably benign Het
Plbd1 T C 6: 136,613,858 I437V probably damaging Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Slc25a26 A G 6: 94,598,403 T198A probably damaging Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Svop T C 5: 114,045,627 T195A probably damaging Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Ush2a C T 1: 188,553,276 T2003I possibly damaging Het
Vmn2r17 T A 5: 109,428,469 V402E probably damaging Het
Vmn2r3 C G 3: 64,275,271 G336R probably damaging Het
Wdr89 A T 12: 75,632,747 D244E probably damaging Het
Other mutations in Slc1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Slc1a3 APN 15 8645687 missense probably damaging 1.00
IGL01133:Slc1a3 APN 15 8650993 missense probably damaging 1.00
IGL01696:Slc1a3 APN 15 8642338 missense probably benign 0.19
IGL03108:Slc1a3 APN 15 8639078 missense probably damaging 1.00
R0128:Slc1a3 UTSW 15 8636209 missense probably benign 0.07
R0206:Slc1a3 UTSW 15 8708556 splice site probably benign
R0312:Slc1a3 UTSW 15 8636237 missense probably benign 0.00
R0385:Slc1a3 UTSW 15 8639135 missense probably damaging 1.00
R0538:Slc1a3 UTSW 15 8650922 missense probably benign
R0579:Slc1a3 UTSW 15 8688309 missense probably damaging 0.98
R1799:Slc1a3 UTSW 15 8688404 missense probably damaging 1.00
R2029:Slc1a3 UTSW 15 8645669 missense probably benign 0.29
R3236:Slc1a3 UTSW 15 8639123 missense probably damaging 0.98
R5010:Slc1a3 UTSW 15 8650846 splice site probably benign
R5154:Slc1a3 UTSW 15 8642949 missense probably benign 0.09
R5226:Slc1a3 UTSW 15 8642225 missense probably damaging 1.00
R5538:Slc1a3 UTSW 15 8645704 missense probably damaging 0.99
R6049:Slc1a3 UTSW 15 8645693 missense probably damaging 1.00
R6072:Slc1a3 UTSW 15 8708568 missense probably damaging 0.99
R6496:Slc1a3 UTSW 15 8649581 missense probably benign 0.01
R7015:Slc1a3 UTSW 15 8649568 missense probably damaging 1.00
R7168:Slc1a3 UTSW 15 8645902 missense possibly damaging 0.79
R7255:Slc1a3 UTSW 15 8642999 missense possibly damaging 0.90
R7476:Slc1a3 UTSW 15 8643084 missense probably damaging 0.99
R7732:Slc1a3 UTSW 15 8650988 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GAGGGAGTTTGCCTGACATG -3'
(R):5'- GAACACGAGTCTTGCGAGGTAC -3'

Sequencing Primer
(F):5'- CCTGACATGTTAGGATGGGACTC -3'
(R):5'- AGGTACTCTCCACTAGGAGA -3'
Posted On2015-07-21