Incidental Mutation 'R4494:Naa60'
ID330907
Institutional Source Beutler Lab
Gene Symbol Naa60
Ensembl Gene ENSMUSG00000005982
Gene NameN(alpha)-acetyltransferase 60, NatF catalytic subunit
Synonyms
MMRRC Submission 041582-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4494 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location3872375-3904780 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 3900721 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 122 (C122*)
Ref Sequence ENSEMBL: ENSMUSP00000135188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006138] [ENSMUST00000006139] [ENSMUST00000115859] [ENSMUST00000115860] [ENSMUST00000135093] [ENSMUST00000143537] [ENSMUST00000147949] [ENSMUST00000150655] [ENSMUST00000151988] [ENSMUST00000175809] [ENSMUST00000176224] [ENSMUST00000176233] [ENSMUST00000176625] [ENSMUST00000186375]
Predicted Effect probably damaging
Transcript: ENSMUST00000006138
AA Change: V139D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006138
Gene: ENSMUSG00000005982
AA Change: V139D

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006139
SMART Domains Protein: ENSMUSP00000006139
Gene: ENSMUSG00000005983

DomainStartEndE-ValueType
Pfam:DUF4644 16 139 7.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115859
SMART Domains Protein: ENSMUSP00000111525
Gene: ENSMUSG00000005983

DomainStartEndE-ValueType
Pfam:DUF4644 2 162 4.7e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115860
AA Change: V139D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111526
Gene: ENSMUSG00000005982
AA Change: V139D

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140832
Predicted Effect probably null
Transcript: ENSMUST00000143537
AA Change: C122*
SMART Domains Protein: ENSMUSP00000135188
Gene: ENSMUSG00000005982
AA Change: C122*

DomainStartEndE-ValueType
SCOP:d1cjwa_ 10 113 9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146935
Predicted Effect probably benign
Transcript: ENSMUST00000147949
Predicted Effect probably damaging
Transcript: ENSMUST00000150655
AA Change: V139D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135206
Gene: ENSMUSG00000005982
AA Change: V139D

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151988
AA Change: V139D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118782
Gene: ENSMUSG00000005982
AA Change: V139D

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 1.1e-11 PFAM
Pfam:Acetyltransf_1 57 156 1.3e-15 PFAM
Pfam:FR47 77 164 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175809
SMART Domains Protein: ENSMUSP00000135810
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
SCOP:d1qsma_ 12 67 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176224
SMART Domains Protein: ENSMUSP00000135152
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
SCOP:d1cjwa_ 10 112 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176233
SMART Domains Protein: ENSMUSP00000135826
Gene: ENSMUSG00000093575

DomainStartEndE-ValueType
Pfam:Cluap1 119 282 2.8e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176625
AA Change: V74D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134768
Gene: ENSMUSG00000005982
AA Change: V74D

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 4 91 1.1e-13 PFAM
Pfam:Acetyltransf_7 7 92 1e-10 PFAM
Pfam:FR47 12 99 1.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177519
Predicted Effect probably damaging
Transcript: ENSMUST00000186375
AA Change: V139D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140031
Gene: ENSMUSG00000005982
AA Change: V139D

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that localizes to the Golgi apparatus, where it transfers an acetyl group to the N-terminus of free proteins. This enzyme acts on histones, and its activity is important for chromatin assembly and chromosome integrity. Alternative splicing and the use of alternative promoters results in multiple transcript variants. The upstream promoter is located in a differentially methylated region (DMR) and undergoes imprinting; transcript variants originating from this position are expressed from the maternal allele. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7ip T A 6: 136,563,749 probably null Het
Cacna1b T C 2: 24,652,938 T1301A probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Camsap1 T C 2: 25,952,758 D262G probably damaging Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Ccdc170 T C 10: 4,514,128 Y36H probably damaging Het
Cd177 A T 7: 24,752,003 S492T probably benign Het
Chrna4 T A 2: 181,028,488 I492F probably damaging Het
Cit T C 5: 115,873,984 Y217H probably damaging Het
Cnbd1 T A 4: 19,098,150 D90V probably benign Het
Cryba2 A G 1: 74,890,630 F116S probably damaging Het
Ctbp1 T C 5: 33,250,869 T240A possibly damaging Het
D130043K22Rik C T 13: 24,871,356 S501L probably benign Het
Ddhd2 A G 8: 25,738,234 F553S probably benign Het
Ddr2 C A 1: 169,988,414 G575W probably damaging Het
Dip2c T C 13: 9,571,062 V537A possibly damaging Het
Dnah12 C T 14: 26,871,855 A752V probably damaging Het
Dnah7a T C 1: 53,449,038 D3260G probably benign Het
Efemp2 T A 19: 5,480,311 C309S probably damaging Het
Fam46a A G 9: 85,325,047 S233P probably damaging Het
Gse1 G A 8: 120,570,814 probably benign Het
Hspa4l T C 3: 40,753,204 S53P possibly damaging Het
Ighv5-4 T C 12: 113,597,584 D72G probably benign Het
Igkv15-103 A G 6: 68,437,796 N73S probably benign Het
Igsf11 T G 16: 39,011,341 N183K possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk18 T C 19: 59,234,831 V136A probably damaging Het
Krt75 A T 15: 101,571,701 Y240* probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Man2a2 C T 7: 80,359,275 probably null Het
Mme A G 3: 63,347,192 N491S probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msi2 T C 11: 88,717,359 D39G possibly damaging Het
Nes A G 3: 87,976,813 E793G probably damaging Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nme6 C T 9: 109,842,054 L121F probably damaging Het
Olfr1297 T A 2: 111,621,148 K309* probably null Het
Otud1 C T 2: 19,659,335 T425I probably damaging Het
Pimreg T C 11: 72,045,138 V149A probably benign Het
Plbd1 T C 6: 136,613,858 I437V probably damaging Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Slc1a3 G A 15: 8,639,095 T462I probably damaging Het
Slc25a26 A G 6: 94,598,403 T198A probably damaging Het
Stkld1 A G 2: 26,946,626 N268S probably benign Het
Svop T C 5: 114,045,627 T195A probably damaging Het
Syt6 A G 3: 103,585,630 E66G probably damaging Het
Tas2r129 A G 6: 132,951,354 I85V probably benign Het
Tprn T C 2: 25,268,892 S643P probably damaging Het
Ush2a C T 1: 188,553,276 T2003I possibly damaging Het
Vmn2r17 T A 5: 109,428,469 V402E probably damaging Het
Vmn2r3 C G 3: 64,275,271 G336R probably damaging Het
Wdr89 A T 12: 75,632,747 D244E probably damaging Het
Other mutations in Naa60
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7522:Naa60 UTSW 16 3901904 missense probably benign
R7776:Naa60 UTSW 16 3900709 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTACAGATCTGGGAGTGTAACCC -3'
(R):5'- TAGCCCTCTAGCCAGGAAATC -3'

Sequencing Primer
(F):5'- ATCTGGGAGTGTAACCCTCTAGAC -3'
(R):5'- TGATCCCTTCCAGCAGTAAAGG -3'
Posted On2015-07-21