Incidental Mutation 'R4495:Olfr1281'
ID330919
Institutional Source Beutler Lab
Gene Symbol Olfr1281
Ensembl Gene ENSMUSG00000095156
Gene Nameolfactory receptor 1281
SynonymsGA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111326520-111332852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111329020 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 200 (N200K)
Ref Sequence ENSEMBL: ENSMUSP00000151304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090326] [ENSMUST00000208176] [ENSMUST00000213551]
Predicted Effect probably benign
Transcript: ENSMUST00000090326
AA Change: N200K

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000087798
Gene: ENSMUSG00000095156
AA Change: N200K

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 301 2.6e-6 PFAM
Pfam:7tm_1 41 287 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208176
AA Change: N200K

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000213551
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Olfr1281
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02426:Olfr1281 APN 2 111328575 missense probably damaging 1.00
IGL02550:Olfr1281 APN 2 111328500 missense probably damaging 1.00
IGL02553:Olfr1281 APN 2 111328988 missense probably benign
IGL02719:Olfr1281 APN 2 111329245 nonsense probably null
IGL02750:Olfr1281 APN 2 111329288 missense probably damaging 1.00
IGL02873:Olfr1281 APN 2 111328872 missense probably benign
IGL03252:Olfr1281 APN 2 111328780 nonsense probably null
IGL03375:Olfr1281 APN 2 111328884 missense probably damaging 1.00
R0055:Olfr1281 UTSW 2 111328525 nonsense probably null
R0368:Olfr1281 UTSW 2 111328787 missense probably damaging 0.99
R0497:Olfr1281 UTSW 2 111328830 missense probably benign 0.00
R0505:Olfr1281 UTSW 2 111329328 missense probably benign 0.00
R1557:Olfr1281 UTSW 2 111328619 missense probably damaging 1.00
R1619:Olfr1281 UTSW 2 111328961 missense probably benign 0.02
R1691:Olfr1281 UTSW 2 111328853 missense probably benign 0.03
R2286:Olfr1281 UTSW 2 111328907 missense probably benign 0.01
R4230:Olfr1281 UTSW 2 111329130 missense probably damaging 1.00
R4274:Olfr1281 UTSW 2 111328815 missense probably damaging 0.98
R4305:Olfr1281 UTSW 2 111329298 missense probably null 0.82
R5307:Olfr1281 UTSW 2 111328396 splice site probably null
R6115:Olfr1281 UTSW 2 111329213 missense probably benign 0.03
R6615:Olfr1281 UTSW 2 111329112 missense probably benign 0.00
R7169:Olfr1281 UTSW 2 111328598 missense probably damaging 1.00
R7601:Olfr1281 UTSW 2 111329220 missense probably benign 0.12
R8267:Olfr1281 UTSW 2 111328815 missense probably benign 0.22
R8447:Olfr1281 UTSW 2 111328962 missense possibly damaging 0.81
Z1177:Olfr1281 UTSW 2 111328825 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCAGCATCATGGACAGACAG -3'
(R):5'- CCCAAGTGATGTTTACTGGCCAC -3'

Sequencing Primer
(F):5'- AGAAGTGCATCTGGCTCG -3'
(R):5'- CCACAGATAGATAAAAATGATGGGCC -3'
Posted On2015-07-21