Incidental Mutation 'R4495:Zfp704'
ID330921
Institutional Source Beutler Lab
Gene Symbol Zfp704
Ensembl Gene ENSMUSG00000040209
Gene Namezinc finger protein 704
SynonymsGig1
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location9427020-9610085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9471077 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 128 (S128C)
Ref Sequence ENSEMBL: ENSMUSP00000141598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041124] [ENSMUST00000193947]
Predicted Effect probably benign
Transcript: ENSMUST00000041124
AA Change: S278C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000041242
Gene: ENSMUSG00000040209
AA Change: S278C

DomainStartEndE-ValueType
low complexity region 12 94 N/A INTRINSIC
low complexity region 98 129 N/A INTRINSIC
low complexity region 267 290 N/A INTRINSIC
ZnF_C2H2 346 371 3.58e-2 SMART
c-clamp 536 566 1.55e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193947
AA Change: S128C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000141598
Gene: ENSMUSG00000040209
AA Change: S128C

DomainStartEndE-ValueType
low complexity region 117 140 N/A INTRINSIC
ZnF_C2H2 196 221 1.6e-4 SMART
c-clamp 475 505 7.4e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile with no obvious developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Zfp704
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Zfp704 APN 3 9565239 missense possibly damaging 0.61
IGL03288:Zfp704 APN 3 9439891 splice site probably benign
R0265:Zfp704 UTSW 3 9565157 missense probably damaging 1.00
R0524:Zfp704 UTSW 3 9609364 missense unknown
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1647:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1648:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1865:Zfp704 UTSW 3 9474491 splice site probably benign
R1912:Zfp704 UTSW 3 9609358 missense unknown
R2109:Zfp704 UTSW 3 9474525 missense probably damaging 1.00
R2566:Zfp704 UTSW 3 9609493 missense unknown
R3551:Zfp704 UTSW 3 9474525 missense probably damaging 1.00
R6165:Zfp704 UTSW 3 9443886 missense probably benign 0.00
R6682:Zfp704 UTSW 3 9565193 missense probably benign 0.11
R7057:Zfp704 UTSW 3 9470917 missense probably damaging 1.00
R7348:Zfp704 UTSW 3 9474598 missense probably damaging 1.00
R7758:Zfp704 UTSW 3 9444222 missense possibly damaging 0.90
R7858:Zfp704 UTSW 3 9444157 critical splice donor site probably null
R8104:Zfp704 UTSW 3 9565241 missense probably benign 0.03
R8373:Zfp704 UTSW 3 9609442 missense unknown
Z1176:Zfp704 UTSW 3 9471044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTTCCTCGGAATGGGC -3'
(R):5'- TGTATGATCTCCACCAATTCCAAG -3'

Sequencing Primer
(F):5'- CTCATCGAAGAGCAGGTTGC -3'
(R):5'- CGGACACTAGAATGCTCACTGAG -3'
Posted On2015-07-21