Incidental Mutation 'R4495:Prdx1'
ID330923
Institutional Source Beutler Lab
Gene Symbol Prdx1
Ensembl Gene ENSMUSG00000028691
Gene Nameperoxiredoxin 1
SynonymsOSF-3, macrophase stress protein 22kDa, Paga, osteoblast specific factor 3, Tdpx2, PrxI, Trx dependent peroxide reductase 2, thioredoxin dependent peroxide reductase 2, macrophage 23kDa stress protein, TDX2, prx1, MSP23, PAG, Prx I
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.653) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116685544-116700822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116699219 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000114159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030453] [ENSMUST00000030454] [ENSMUST00000106470] [ENSMUST00000135573]
Predicted Effect probably benign
Transcript: ENSMUST00000030453
SMART Domains Protein: ENSMUSP00000030453
Gene: ENSMUSG00000028690

DomainStartEndE-ValueType
Pfam:MMACHC 20 234 9.5e-102 PFAM
low complexity region 243 257 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030454
SMART Domains Protein: ENSMUSP00000030454
Gene: ENSMUSG00000028691

DomainStartEndE-ValueType
Pfam:Redoxin 7 158 1.1e-18 PFAM
Pfam:AhpC-TSA 8 142 9e-44 PFAM
Pfam:1-cysPrx_C 162 176 8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106470
AA Change: V188A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102078
Gene: ENSMUSG00000028691
AA Change: V188A

DomainStartEndE-ValueType
Pfam:Redoxin 7 157 2.7e-17 PFAM
Pfam:AhpC-TSA 8 142 6.1e-42 PFAM
Pfam:1-cysPrx_C 162 197 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135573
AA Change: V188A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114159
Gene: ENSMUSG00000028691
AA Change: V188A

DomainStartEndE-ValueType
Pfam:Redoxin 7 158 3.8e-18 PFAM
Pfam:AhpC-TSA 8 142 2.8e-43 PFAM
Pfam:1-cysPrx_C 162 197 2.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in cells, and may contribute to the antiviral activity of CD8(+) T-cells. This protein may have a proliferative effect and play a role in cancer development or progression. Four transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mutant mice exhibit defects in antioxidant defense that manifest as hemolytic anemia and malignancies. The phenotype is more severe in homozygous mutant mice which die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Prdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Prdx1 APN 4 116692965 missense probably benign 0.03
IGL00654:Prdx1 APN 4 116692950 missense probably benign 0.01
IGL00769:Prdx1 APN 4 116692965 missense probably benign 0.03
IGL00851:Prdx1 APN 4 116692950 missense probably benign 0.01
IGL02224:Prdx1 APN 4 116691867 missense probably damaging 1.00
R1891:Prdx1 UTSW 4 116699254 makesense probably null
R2568:Prdx1 UTSW 4 116693800 missense probably benign 0.00
R4971:Prdx1 UTSW 4 116691931 critical splice donor site probably null
R5610:Prdx1 UTSW 4 116692927 missense probably damaging 1.00
R5630:Prdx1 UTSW 4 116699217 missense probably benign 0.00
R5828:Prdx1 UTSW 4 116693809 missense probably damaging 1.00
R7861:Prdx1 UTSW 4 116693738 missense probably benign
R8312:Prdx1 UTSW 4 116699201 missense possibly damaging 0.83
Z1176:Prdx1 UTSW 4 116687481 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGGAATTTGGCCAAGATAGG -3'
(R):5'- GGAAGAAAGGCTATCCATCCCC -3'

Sequencing Primer
(F):5'- CCAAGATAGGTCTCACTTGGCTAG -3'
(R):5'- CAGCCCTGTAGGAAAGGCTTATCTG -3'
Posted On2015-07-21