Incidental Mutation 'R4495:Ifnlr1'
ID330924
Institutional Source Beutler Lab
Gene Symbol Ifnlr1
Ensembl Gene ENSMUSG00000062157
Gene Nameinterferon lambda receptor 1
SynonymsIFNLR1, Il28ra, CRF2-12
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135686287-135708181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135705768 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 505 (E505V)
Ref Sequence ENSEMBL: ENSMUSP00000074009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074408]
Predicted Effect probably damaging
Transcript: ENSMUST00000074408
AA Change: E505V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074009
Gene: ENSMUSG00000062157
AA Change: E505V

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
FN3 24 108 7.75e0 SMART
transmembrane domain 226 248 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 376 397 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and normal with respect to viral infection, however antiviral response evoked by TLRs are significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Ifnlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Ifnlr1 APN 4 135704285 missense probably benign 0.28
IGL01637:Ifnlr1 APN 4 135686545 missense possibly damaging 0.63
IGL02090:Ifnlr1 APN 4 135705267 missense probably benign 0.23
R0677:Ifnlr1 UTSW 4 135705634 missense possibly damaging 0.78
R0723:Ifnlr1 UTSW 4 135701213 splice site probably benign
R0762:Ifnlr1 UTSW 4 135701329 missense possibly damaging 0.90
R1169:Ifnlr1 UTSW 4 135705108 missense probably benign 0.00
R1303:Ifnlr1 UTSW 4 135704217 missense possibly damaging 0.67
R1819:Ifnlr1 UTSW 4 135686523 start gained probably benign
R1957:Ifnlr1 UTSW 4 135686570 missense probably damaging 1.00
R2041:Ifnlr1 UTSW 4 135705837 missense possibly damaging 0.51
R2509:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R2510:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R2511:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R3020:Ifnlr1 UTSW 4 135705730 small deletion probably benign
R3944:Ifnlr1 UTSW 4 135701228 missense probably damaging 1.00
R4804:Ifnlr1 UTSW 4 135705336 missense possibly damaging 0.50
R4938:Ifnlr1 UTSW 4 135705282 missense probably benign 0.35
R5070:Ifnlr1 UTSW 4 135704198 missense probably benign 0.00
R5073:Ifnlr1 UTSW 4 135705146 missense probably benign 0.06
R5493:Ifnlr1 UTSW 4 135705566 missense probably benign 0.25
R5913:Ifnlr1 UTSW 4 135705269 missense probably damaging 1.00
R5913:Ifnlr1 UTSW 4 135705270 missense probably damaging 1.00
R5959:Ifnlr1 UTSW 4 135705341 missense possibly damaging 0.94
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6136:Ifnlr1 UTSW 4 135703797 missense possibly damaging 0.92
R7018:Ifnlr1 UTSW 4 135703824 missense possibly damaging 0.77
R7651:Ifnlr1 UTSW 4 135690608 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATTTTCTGAGGACTTGGGCAC -3'
(R):5'- TCAAAGGGACATGACTCTCGG -3'

Sequencing Primer
(F):5'- TCTGAAGGATGGCCTCTCC -3'
(R):5'- ACATGACTCTCGGAGGTGTC -3'
Posted On2015-07-21