Incidental Mutation 'R4495:Tmprss11b'
ID330926
Institutional Source Beutler Lab
Gene Symbol Tmprss11b
Ensembl Gene ENSMUSG00000035861
Gene Nametransmembrane protease, serine 11B
SynonymsTmprss11bnl, 9930019B18Rik
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86657631-86676362 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 86665063 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 125 (K125*)
Ref Sequence ENSEMBL: ENSMUSP00000042406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038448]
Predicted Effect probably null
Transcript: ENSMUST00000038448
AA Change: K125*
SMART Domains Protein: ENSMUSP00000042406
Gene: ENSMUSG00000035861
AA Change: K125*

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:SEA 46 148 2.3e-26 PFAM
Tryp_SPc 184 410 6.19e-89 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Tmprss11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Tmprss11b APN 5 86663517 missense probably benign
IGL02340:Tmprss11b APN 5 86662231 missense probably benign
IGL02500:Tmprss11b APN 5 86667323 critical splice donor site probably null
demolished UTSW 5 86664314 missense probably damaging 1.00
R0356:Tmprss11b UTSW 5 86660467 makesense probably null
R0506:Tmprss11b UTSW 5 86661640 missense probably damaging 1.00
R0528:Tmprss11b UTSW 5 86671894 missense probably damaging 1.00
R1424:Tmprss11b UTSW 5 86664973 missense probably benign 0.09
R1471:Tmprss11b UTSW 5 86660496 missense possibly damaging 0.76
R1554:Tmprss11b UTSW 5 86661631 missense probably benign 0.01
R3436:Tmprss11b UTSW 5 86667584 nonsense probably null
R3829:Tmprss11b UTSW 5 86661590 missense probably damaging 0.98
R4409:Tmprss11b UTSW 5 86664278 missense probably benign 0.26
R4624:Tmprss11b UTSW 5 86665036 missense probably benign 0.04
R4834:Tmprss11b UTSW 5 86663559 missense probably damaging 1.00
R5436:Tmprss11b UTSW 5 86662233 missense probably benign 0.10
R5812:Tmprss11b UTSW 5 86665098 missense possibly damaging 0.67
R6262:Tmprss11b UTSW 5 86662260 missense probably benign 0.07
R6882:Tmprss11b UTSW 5 86671671 splice site probably null
R6893:Tmprss11b UTSW 5 86663386 critical splice donor site probably null
R7312:Tmprss11b UTSW 5 86664314 missense probably damaging 1.00
R7771:Tmprss11b UTSW 5 86661695 splice site probably null
R8101:Tmprss11b UTSW 5 86664962 critical splice donor site probably null
X0067:Tmprss11b UTSW 5 86662200 missense probably damaging 1.00
Z1177:Tmprss11b UTSW 5 86660541 missense probably damaging 1.00
Z1177:Tmprss11b UTSW 5 86661613 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACTTGGTGTTTATGACATGTCCTAG -3'
(R):5'- AGAGCTGTGCATCTTCAGTTGAC -3'

Sequencing Primer
(F):5'- TGACATGTCCTAGGCACAAAATG -3'
(R):5'- CAGACTAGAAGCTTCATCCTGAGTG -3'
Posted On2015-07-21