Incidental Mutation 'R4495:Klra10'
ID330929
Institutional Source Beutler Lab
Gene Symbol Klra10
Ensembl Gene ENSMUSG00000072718
Gene Namekiller cell lectin-like receptor subfamily A, member 10
SynonymsLy49i2, Ly49J
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location130269194-130281928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 130279348 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 114 (E114D)
Ref Sequence ENSEMBL: ENSMUSP00000107651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112020]
Predicted Effect probably benign
Transcript: ENSMUST00000112020
AA Change: E114D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107651
Gene: ENSMUSG00000072718
AA Change: E114D

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 117 2e-9 BLAST
CLECT 143 258 6.43e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Klra10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Klra10 APN 6 130272717 missense probably damaging 1.00
IGL02060:Klra10 APN 6 130272725 missense probably damaging 0.99
IGL02249:Klra10 APN 6 130279404 missense probably benign 0.07
IGL02681:Klra10 APN 6 130279419 missense probably damaging 0.98
IGL02684:Klra10 APN 6 130281882 missense possibly damaging 0.85
FR4342:Klra10 UTSW 6 130272747 missense probably benign 0.01
R0324:Klra10 UTSW 6 130272650 splice site probably null
R1072:Klra10 UTSW 6 130281848 missense probably benign 0.11
R1466:Klra10 UTSW 6 130279315 missense probably damaging 1.00
R1466:Klra10 UTSW 6 130279431 missense probably damaging 0.98
R1466:Klra10 UTSW 6 130279315 missense probably damaging 1.00
R1466:Klra10 UTSW 6 130279431 missense probably damaging 0.98
R2125:Klra10 UTSW 6 130279278 missense probably damaging 0.98
R2266:Klra10 UTSW 6 130269301 missense probably benign 0.13
R2427:Klra10 UTSW 6 130279335 missense probably benign 0.00
R4260:Klra10 UTSW 6 130272681 missense probably damaging 1.00
R5897:Klra10 UTSW 6 130281829 nonsense probably null
R6123:Klra10 UTSW 6 130279376 missense probably benign 0.04
R6221:Klra10 UTSW 6 130269272 missense probably benign
R6478:Klra10 UTSW 6 130272544 splice site probably null
R6520:Klra10 UTSW 6 130275792 missense probably benign 0.03
R6551:Klra10 UTSW 6 130275755 missense probably benign 0.36
R7445:Klra10 UTSW 6 130275856 missense probably benign 0.38
R7453:Klra10 UTSW 6 130280364 missense probably damaging 0.98
R7744:Klra10 UTSW 6 130272761 critical splice acceptor site probably null
R8079:Klra10 UTSW 6 130275775 missense probably benign
R8320:Klra10 UTSW 6 130269248 missense probably damaging 1.00
RF060:Klra10 UTSW 6 130275821 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTTAAGCTGCTGGATGTACTTC -3'
(R):5'- ATATGTGTCGGCTCTCCACATG -3'

Sequencing Primer
(F):5'- AGCTGCTGGATGTACTTCAAAGC -3'
(R):5'- TCGGCTCTCCACATGAAGCC -3'
Posted On2015-07-21