Incidental Mutation 'R4495:Ddx47'
ID330930
Institutional Source Beutler Lab
Gene Symbol Ddx47
Ensembl Gene ENSMUSG00000030204
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Synonyms
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location135011612-135023776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135021466 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 375 (F375S)
Ref Sequence ENSEMBL: ENSMUSP00000032326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032326] [ENSMUST00000130851] [ENSMUST00000205055] [ENSMUST00000205244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032326
AA Change: F375S

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032326
Gene: ENSMUSG00000030204
AA Change: F375S

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
DEXDc 43 241 6.38e-61 SMART
HELICc 277 358 8.21e-32 SMART
low complexity region 413 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123022
Predicted Effect probably benign
Transcript: ENSMUST00000130851
SMART Domains Protein: ENSMUSP00000115183
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
Blast:DEXDc 30 59 9e-12 BLAST
Pfam:Helicase_C 99 138 2.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134549
Predicted Effect unknown
Transcript: ENSMUST00000154558
AA Change: F322S
SMART Domains Protein: ENSMUSP00000119231
Gene: ENSMUSG00000030204
AA Change: F322S

DomainStartEndE-ValueType
low complexity region 13 20 N/A INTRINSIC
DEXDc 40 238 6.38e-61 SMART
HELICc 229 306 3.67e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155277
Predicted Effect unknown
Transcript: ENSMUST00000204646
AA Change: F350S
Predicted Effect probably benign
Transcript: ENSMUST00000205055
SMART Domains Protein: ENSMUSP00000145463
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
DEXDc 43 178 1.7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205244
SMART Domains Protein: ENSMUSP00000145139
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
DEXDc 6 178 3e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene can shuttle between the nucleus and the cytoplasm, and has an RNA-independent ATPase activity. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Palm3 C T 8: 84,026,866 R97C probably damaging Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Ddx47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02719:Ddx47 APN 6 135017151 missense probably benign 0.06
PIT4466001:Ddx47 UTSW 6 135015840 missense probably benign 0.31
R0304:Ddx47 UTSW 6 135017220 missense possibly damaging 0.62
R0617:Ddx47 UTSW 6 135017122 missense probably damaging 1.00
R1223:Ddx47 UTSW 6 135012314 missense possibly damaging 0.70
R1468:Ddx47 UTSW 6 135011740 splice site probably benign
R2005:Ddx47 UTSW 6 135018121 missense probably benign 0.06
R2134:Ddx47 UTSW 6 135015350 nonsense probably null
R2993:Ddx47 UTSW 6 135018981 missense probably damaging 1.00
R3714:Ddx47 UTSW 6 135019062 missense probably damaging 1.00
R4352:Ddx47 UTSW 6 135018055 missense probably benign 0.38
R4355:Ddx47 UTSW 6 135021505 missense probably benign
R4664:Ddx47 UTSW 6 135012356 missense possibly damaging 0.95
R5527:Ddx47 UTSW 6 135011694 missense probably benign 0.35
R6119:Ddx47 UTSW 6 135023355 missense probably benign
R7038:Ddx47 UTSW 6 135023373 missense possibly damaging 0.84
R7270:Ddx47 UTSW 6 135023338 missense probably benign 0.08
X0026:Ddx47 UTSW 6 135023389 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGGGCTAGAATAACTGTGTCTG -3'
(R):5'- AACCTCAAGTGTCTGATGGGG -3'

Sequencing Primer
(F):5'- CACATGAATGTCTTGTGCCTGCAG -3'
(R):5'- CTGATGGGGTAAGGCCATC -3'
Posted On2015-07-21