Incidental Mutation 'R4495:Palm3'
ID330934
Institutional Source Beutler Lab
Gene Symbol Palm3
Ensembl Gene ENSMUSG00000047986
Gene Nameparalemmin 3
Synonyms
MMRRC Submission 041583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4495 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84021471-84030295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84026866 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 97 (R97C)
Ref Sequence ENSEMBL: ENSMUSP00000051396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000055077]
Predicted Effect probably benign
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000055077
AA Change: R97C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051396
Gene: ENSMUSG00000047986
AA Change: R97C

DomainStartEndE-ValueType
coiled coil region 19 64 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
coiled coil region 90 116 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
low complexity region 248 261 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
low complexity region 399 416 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 707 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210245
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calcr A T 6: 3,708,484 probably null Het
Cdh4 T C 2: 179,780,389 V102A probably damaging Het
Cmya5 T C 13: 93,094,065 E1505G probably benign Het
Cyp2b9 T A 7: 26,200,755 D329E probably benign Het
Ddx47 T C 6: 135,021,466 F375S possibly damaging Het
Dnah7b T G 1: 46,085,632 S154A probably benign Het
Fry G T 5: 150,310,463 E133D probably damaging Het
Hydin T C 8: 110,595,402 L4562P probably damaging Het
Ifnlr1 A T 4: 135,705,768 E505V probably damaging Het
Igfn1 T C 1: 135,969,678 E1050G possibly damaging Het
Kidins220 T A 12: 25,038,302 probably null Het
Klra10 T G 6: 130,279,348 E114D probably benign Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra3 T C 7: 47,590,065 I38V probably benign Het
Nfkb2 A G 19: 46,308,439 D316G probably damaging Het
Nrxn2 A T 19: 6,531,399 T412S probably benign Het
Olfr1281 T A 2: 111,329,020 N200K probably benign Het
Pdcd11 T C 19: 47,111,006 V848A probably benign Het
Prdx1 T C 4: 116,699,219 V188A probably benign Het
Prep T C 10: 45,120,819 F398L probably benign Het
Prlhr A T 19: 60,467,081 M349K probably benign Het
Rwdd2b T C 16: 87,434,562 T235A probably benign Het
Scn1a T C 2: 66,280,802 probably null Het
Sidt1 C T 16: 44,282,478 V295M probably damaging Het
Sla T C 15: 66,801,512 T10A probably benign Het
Slc22a20 A G 19: 5,984,924 S170P probably benign Het
Syt6 C A 3: 103,587,560 C280* probably null Het
Thbs2 A G 17: 14,671,413 I954T probably damaging Het
Tmprss11b T A 5: 86,665,063 K125* probably null Het
Ugt1a6a T A 1: 88,139,183 L237H probably damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Wdr53 A G 16: 32,252,151 T105A probably benign Het
Xkrx T C X: 134,150,996 N302S possibly damaging Het
Zfp704 T A 3: 9,471,077 S128C probably benign Het
Zfp759 A G 13: 67,138,925 probably null Het
Zfyve16 A T 13: 92,488,567 D1494E probably benign Het
Other mutations in Palm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Palm3 APN 8 84029445 missense possibly damaging 0.90
IGL02634:Palm3 APN 8 84028865 missense probably damaging 0.99
IGL02710:Palm3 APN 8 84028312 missense possibly damaging 0.75
R0277:Palm3 UTSW 8 84028720 missense probably damaging 1.00
R0323:Palm3 UTSW 8 84028720 missense probably damaging 1.00
R0422:Palm3 UTSW 8 84028863 missense possibly damaging 0.94
R0507:Palm3 UTSW 8 84028329 missense probably benign 0.00
R0835:Palm3 UTSW 8 84028147 missense probably benign
R1037:Palm3 UTSW 8 84029272 missense probably benign
R1618:Palm3 UTSW 8 84029662 missense possibly damaging 0.92
R1621:Palm3 UTSW 8 84030022 missense possibly damaging 0.93
R1797:Palm3 UTSW 8 84028803 missense probably benign 0.00
R1989:Palm3 UTSW 8 84030022 missense possibly damaging 0.93
R3618:Palm3 UTSW 8 84029344 missense probably benign 0.00
R3619:Palm3 UTSW 8 84029344 missense probably benign 0.00
R4588:Palm3 UTSW 8 84029386 missense probably benign 0.20
R4687:Palm3 UTSW 8 84029935 missense probably benign 0.00
R4948:Palm3 UTSW 8 84027079 nonsense probably null
R5265:Palm3 UTSW 8 84021530 critical splice donor site probably null
R5951:Palm3 UTSW 8 84029420 missense probably benign 0.02
R6580:Palm3 UTSW 8 84029548 missense probably damaging 1.00
R7237:Palm3 UTSW 8 84029488 missense probably benign 0.00
R7562:Palm3 UTSW 8 84021507 missense possibly damaging 0.87
R7676:Palm3 UTSW 8 84029445 missense possibly damaging 0.90
R7923:Palm3 UTSW 8 84029461 missense probably benign
R8118:Palm3 UTSW 8 84029809 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGGACATGTCTCCCATCCTG -3'
(R):5'- TGTGGACGCACTTTGCAAC -3'

Sequencing Primer
(F):5'- TGATGGATGCGCCCTCTG -3'
(R):5'- GCACTTTGCAACAGCTGTAG -3'
Posted On2015-07-21